Incidental Mutation 'R8379:Tcp11l2'
ID 646872
Institutional Source Beutler Lab
Gene Symbol Tcp11l2
Ensembl Gene ENSMUSG00000020034
Gene Name t-complex 11 (mouse) like 2
Synonyms E430026E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R8379 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84576626-84614359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84613605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 478 (Y478C)
Ref Sequence ENSEMBL: ENSMUSP00000020223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020223]
AlphaFold Q8K1H7
Predicted Effect probably damaging
Transcript: ENSMUST00000020223
AA Change: Y478C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034
AA Change: Y478C

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:Tcp11 77 497 5.8e-103 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 T C 11: 72,029,300 D314G probably benign Het
Ankrd12 T G 17: 65,983,944 E1498A probably benign Het
Appl1 A T 14: 26,925,415 probably null Het
Auh A G 13: 52,909,313 *116R probably null Het
Ccdc7a T A 8: 128,964,936 H402L probably benign Het
Ccr4 T C 9: 114,492,167 T277A probably benign Het
Col18a1 C T 10: 77,053,238 V1302I probably benign Het
Csnk1a1 T C 18: 61,555,854 I35T probably benign Het
Csnk1e T C 15: 79,420,682 R374G possibly damaging Het
Ddx11 A G 17: 66,130,025 R105G probably benign Het
Denr C A 5: 123,927,061 T159K possibly damaging Het
Dmp1 C A 5: 104,211,705 Y82* probably null Het
Dok3 A G 13: 55,524,020 V246A probably benign Het
Endov A C 11: 119,491,897 K57Q possibly damaging Het
Fam160a2 T C 7: 105,385,135 N430D possibly damaging Het
Fam83a A G 15: 58,009,800 T342A probably benign Het
Fbln1 G A 15: 85,232,572 C275Y probably damaging Het
Foxi1 A G 11: 34,207,530 I165T possibly damaging Het
Gm14496 A T 2: 182,000,482 I649F probably damaging Het
Gm9268 C T 7: 43,047,846 P776S probably damaging Het
Grin2b A G 6: 135,922,969 S305P probably damaging Het
Grm1 G A 10: 10,689,135 T1143M possibly damaging Het
Ifi202b C A 1: 173,974,732 probably null Het
Klhl32 A T 4: 24,629,194 D491E probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Krt13 A G 11: 100,118,880 L358P probably damaging Het
Limk2 G A 11: 3,371,162 probably benign Het
Mdn1 A G 4: 32,756,453 D4720G probably null Het
Mkln1 T A 6: 31,458,965 Y286* probably null Het
Muc6 C A 7: 141,644,312 E1143* probably null Het
Myh15 A G 16: 49,081,188 I242M probably benign Het
Noc4l T G 5: 110,650,962 K241Q probably damaging Het
Nup88 C A 11: 70,969,781 L57F possibly damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr612 A G 7: 103,538,976 I86T possibly damaging Het
Orm1 A T 4: 63,346,118 D137V probably damaging Het
Osbpl2 T A 2: 180,137,102 D9E probably damaging Het
P4ha3 G T 7: 100,293,779 D124Y probably damaging Het
Poteg T C 8: 27,453,326 V208A probably benign Het
Ppfibp1 A G 6: 147,030,345 D963G probably damaging Het
Prdx6 G T 1: 161,251,090 D9E probably benign Het
Prrc2b C A 2: 32,214,654 N1381K probably damaging Het
Ptpn14 T A 1: 189,833,401 V222E possibly damaging Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rexo5 A T 7: 119,834,285 M422L probably benign Het
Rnf17 TG T 14: 56,424,542 132 probably null Het
Robo2 A T 16: 73,933,700 I1008N probably damaging Het
Sidt1 T A 16: 44,286,392 Y225F probably benign Het
Slc6a15 A T 10: 103,389,187 E45D probably benign Het
Spata31d1a T G 13: 59,702,854 M487L probably benign Het
St6galnac1 C A 11: 116,775,499 probably benign Het
Tdrd12 G T 7: 35,524,057 C67* probably null Het
Tead2 G A 7: 45,218,081 G78D probably damaging Het
Tfpi2 A T 6: 3,963,849 N194K probably damaging Het
Timd2 A G 11: 46,677,200 probably null Het
Tmem270 T C 5: 134,901,703 T235A probably benign Het
Tnrc18 T C 5: 142,788,402 D224G Het
Tsga10 G T 1: 37,801,878 Q416K probably benign Het
Ulk1 C A 5: 110,787,665 L911F probably damaging Het
Usp8 T C 2: 126,742,571 S567P probably benign Het
Zdhhc3 A C 9: 123,089,078 C129G probably damaging Het
Other mutations in Tcp11l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Tcp11l2 APN 10 84594710 missense possibly damaging 0.82
IGL00845:Tcp11l2 APN 10 84604983 missense possibly damaging 0.95
IGL02375:Tcp11l2 APN 10 84605068 critical splice donor site probably null
IGL02418:Tcp11l2 APN 10 84613606 nonsense probably null
IGL03325:Tcp11l2 APN 10 84604900 missense possibly damaging 0.76
R0031:Tcp11l2 UTSW 10 84591140 missense probably damaging 0.98
R0591:Tcp11l2 UTSW 10 84604594 missense probably benign 0.05
R1563:Tcp11l2 UTSW 10 84584944 missense probably damaging 0.96
R1607:Tcp11l2 UTSW 10 84613487 missense probably damaging 1.00
R1840:Tcp11l2 UTSW 10 84604599 missense probably damaging 0.98
R2144:Tcp11l2 UTSW 10 84613499 missense probably damaging 1.00
R2251:Tcp11l2 UTSW 10 84605069 critical splice donor site probably null
R4289:Tcp11l2 UTSW 10 84605073 splice site probably null
R4639:Tcp11l2 UTSW 10 84584936 missense probably damaging 1.00
R4844:Tcp11l2 UTSW 10 84613691 missense probably benign 0.00
R4973:Tcp11l2 UTSW 10 84591163 missense probably damaging 0.98
R5264:Tcp11l2 UTSW 10 84613660 missense probably damaging 1.00
R5970:Tcp11l2 UTSW 10 84594797 splice site probably benign
R6966:Tcp11l2 UTSW 10 84591269 missense possibly damaging 0.79
R7250:Tcp11l2 UTSW 10 84587241 critical splice donor site probably null
R7535:Tcp11l2 UTSW 10 84594659 missense possibly damaging 0.67
R7565:Tcp11l2 UTSW 10 84587134 missense probably damaging 1.00
R7619:Tcp11l2 UTSW 10 84594758 missense probably damaging 1.00
R7774:Tcp11l2 UTSW 10 84604983 missense possibly damaging 0.95
R8145:Tcp11l2 UTSW 10 84608616 missense probably damaging 1.00
R8458:Tcp11l2 UTSW 10 84613532 nonsense probably null
R8821:Tcp11l2 UTSW 10 84613658 missense probably damaging 1.00
R8831:Tcp11l2 UTSW 10 84613658 missense probably damaging 1.00
RF008:Tcp11l2 UTSW 10 84613524 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTATGTACTTCAATAACGGAACCAG -3'
(R):5'- GGTTACACGGATGCAGTCTAGG -3'

Sequencing Primer
(F):5'- GTACTTCAATAACGGAACCAGTAAAG -3'
(R):5'- GAGAATGGGCCACATCTCCAATG -3'
Posted On 2020-09-02