Mutagenetix > Incidental Mutation

Incidental Mutation 'R8379:Muc6'

646865

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

067810-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R8379 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141213373-141241641 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 141230579 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1143 (E1143*)

Ref Sequence

ENSEMBL: ENSMUSP00000140388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000062451
AA Change: E1184*

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: E1184*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000189314
AA Change: E1143*

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191
AA Change: E1143*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000190907
AA Change: E1184*

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: E1184*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aipl1	T	C	11: 71,920,126 (GRCm39)	D314G	probably benign	Het
Ankrd12	T	G	17: 66,290,939 (GRCm39)	E1498A	probably benign	Het
Appl1	A	T	14: 26,647,372 (GRCm39)		probably null	Het
Auh	A	G	13: 53,063,349 (GRCm39)	*116R	probably null	Het
Ccdc7a	T	A	8: 129,691,417 (GRCm39)	H402L	probably benign	Het
Ccr4	T	C	9: 114,321,235 (GRCm39)	T277A	probably benign	Het
Col18a1	C	T	10: 76,889,072 (GRCm39)	V1302I	probably benign	Het
Csnk1a1	T	C	18: 61,688,925 (GRCm39)	I35T	probably benign	Het
Csnk1e	T	C	15: 79,304,882 (GRCm39)	R374G	possibly damaging	Het
Ddx11	A	G	17: 66,437,020 (GRCm39)	R105G	probably benign	Het
Denr	C	A	5: 124,065,124 (GRCm39)	T159K	possibly damaging	Het
Dmp1	C	A	5: 104,359,571 (GRCm39)	Y82*	probably null	Het
Dok3	A	G	13: 55,671,833 (GRCm39)	V246A	probably benign	Het
Endov	A	C	11: 119,382,723 (GRCm39)	K57Q	possibly damaging	Het
Fam83a	A	G	15: 57,873,196 (GRCm39)	T342A	probably benign	Het
Fbln1	G	A	15: 85,116,773 (GRCm39)	C275Y	probably damaging	Het
Fhip1b	T	C	7: 105,034,342 (GRCm39)	N430D	possibly damaging	Het
Foxi1	A	G	11: 34,157,530 (GRCm39)	I165T	possibly damaging	Het
Gm14496	A	T	2: 181,642,275 (GRCm39)	I649F	probably damaging	Het
Grin2b	A	G	6: 135,899,967 (GRCm39)	S305P	probably damaging	Het
Grm1	G	A	10: 10,564,879 (GRCm39)	T1143M	possibly damaging	Het
Ifi202b	C	A	1: 173,802,298 (GRCm39)		probably null	Het
Klhl32	A	T	4: 24,629,194 (GRCm39)	D491E	probably damaging	Het
Klk1b1	C	T	7: 43,619,767 (GRCm39)	R109C	possibly damaging	Het
Krt13	A	G	11: 100,009,706 (GRCm39)	L358P	probably damaging	Het
Limk2	G	A	11: 3,321,162 (GRCm39)		probably benign	Het
Mdn1	A	G	4: 32,756,453 (GRCm39)	D4720G	probably null	Het
Mkln1	T	A	6: 31,435,900 (GRCm39)	Y286*	probably null	Het
Myh15	A	G	16: 48,901,551 (GRCm39)	I242M	probably benign	Het
Noc4l	T	G	5: 110,798,828 (GRCm39)	K241Q	probably damaging	Het
Nup88	C	A	11: 70,860,607 (GRCm39)	L57F	possibly damaging	Het
Obsl1	G	T	1: 75,480,501 (GRCm39)	F374L	possibly damaging	Het
Or51aa2	A	G	7: 103,188,183 (GRCm39)	I86T	possibly damaging	Het
Orm1	A	T	4: 63,264,355 (GRCm39)	D137V	probably damaging	Het
Osbpl2	T	A	2: 179,778,895 (GRCm39)	D9E	probably damaging	Het
P4ha3	G	T	7: 99,942,986 (GRCm39)	D124Y	probably damaging	Het
Poteg	T	C	8: 27,943,354 (GRCm39)	V208A	probably benign	Het
Ppfibp1	A	G	6: 146,931,843 (GRCm39)	D963G	probably damaging	Het
Prdx6	G	T	1: 161,078,660 (GRCm39)	D9E	probably benign	Het
Prrc2b	C	A	2: 32,104,666 (GRCm39)	N1381K	probably damaging	Het
Ptpn14	T	A	1: 189,565,598 (GRCm39)	V222E	possibly damaging	Het
Rasal1	C	T	5: 120,804,420 (GRCm39)	R431C	probably benign	Het
Rexo5	A	T	7: 119,433,508 (GRCm39)	M422L	probably benign	Het
Rnf17	TG	T	14: 56,661,999 (GRCm39)	132	probably null	Het
Robo2	A	T	16: 73,730,588 (GRCm39)	I1008N	probably damaging	Het
Sidt1	T	A	16: 44,106,755 (GRCm39)	Y225F	probably benign	Het
Slc6a15	A	T	10: 103,225,048 (GRCm39)	E45D	probably benign	Het
Spata31d1a	T	G	13: 59,850,668 (GRCm39)	M487L	probably benign	Het
St6galnac1	C	A	11: 116,666,325 (GRCm39)		probably benign	Het
Tcp11l2	A	G	10: 84,449,469 (GRCm39)	Y478C	probably damaging	Het
Tdrd12	G	T	7: 35,223,482 (GRCm39)	C67*	probably null	Het
Tead2	G	A	7: 44,867,505 (GRCm39)	G78D	probably damaging	Het
Tfpi2	A	T	6: 3,963,849 (GRCm39)	N194K	probably damaging	Het
Timd2	A	G	11: 46,568,027 (GRCm39)		probably null	Het
Tmem270	T	C	5: 134,930,557 (GRCm39)	T235A	probably benign	Het
Tnrc18	T	C	5: 142,774,157 (GRCm39)	D224G		Het
Tsga10	G	T	1: 37,840,959 (GRCm39)	Q416K	probably benign	Het
Ulk1	C	A	5: 110,935,531 (GRCm39)	L911F	probably damaging	Het
Usp8	T	C	2: 126,584,491 (GRCm39)	S567P	probably benign	Het
Vmn2r-ps158	C	T	7: 42,697,270 (GRCm39)	P776S	probably damaging	Het
Zdhhc3	A	C	9: 122,918,143 (GRCm39)	C129G	probably damaging	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141,232,169 (GRCm39)	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141,638,890 (GRCm38)	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141,234,333 (GRCm39)	nonsense	probably null
IGL01021:Muc6	APN	7	141,217,075 (GRCm39)	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141,234,720 (GRCm39)	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141,232,926 (GRCm39)	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141,218,527 (GRCm39)	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141,237,572 (GRCm39)	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141,236,306 (GRCm39)	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141,236,069 (GRCm39)	nonsense	probably null
IGL01810:Muc6	APN	7	141,237,327 (GRCm39)	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141,226,117 (GRCm39)	intron	probably benign
IGL02192:Muc6	APN	7	141,217,717 (GRCm39)	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141,235,889 (GRCm39)	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141,226,842 (GRCm39)	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141,227,763 (GRCm39)	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141,226,726 (GRCm39)	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141,216,853 (GRCm39)	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141,235,843 (GRCm39)	splice site	probably benign
IGL02851:Muc6	APN	7	141,234,627 (GRCm39)	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141,226,414 (GRCm39)	intron	probably benign
IGL03070:Muc6	APN	7	141,230,834 (GRCm39)	splice site	probably benign
IGL03108:Muc6	APN	7	141,217,402 (GRCm39)	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141,238,324 (GRCm39)	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141,234,349 (GRCm39)	missense	probably damaging	1.00
anticipation	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
F5770:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141,214,029 (GRCm39)	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141,216,868 (GRCm39)	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141,238,548 (GRCm39)	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141,226,735 (GRCm39)	missense	probably benign
R0503:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141,218,497 (GRCm39)	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0880:Muc6	UTSW	7	141,217,270 (GRCm39)	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141,230,500 (GRCm39)	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141,232,122 (GRCm39)	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141,226,464 (GRCm39)	intron	probably benign
R1293:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141,234,176 (GRCm39)	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1548:Muc6	UTSW	7	141,238,368 (GRCm39)	splice site	probably benign
R1576:Muc6	UTSW	7	141,214,437 (GRCm39)	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141,234,265 (GRCm39)	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141,236,752 (GRCm39)	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141,214,371 (GRCm39)	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141,217,011 (GRCm39)	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141,226,330 (GRCm39)	intron	probably benign
R1964:Muc6	UTSW	7	141,226,329 (GRCm39)	nonsense	probably null
R1975:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141,213,991 (GRCm39)	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141,236,075 (GRCm39)	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141,233,227 (GRCm39)	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141,217,837 (GRCm39)	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141,217,444 (GRCm39)	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141,226,651 (GRCm39)	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141,216,951 (GRCm39)	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141,234,946 (GRCm39)	splice site	probably benign
R3872:Muc6	UTSW	7	141,226,867 (GRCm39)	missense	probably benign
R4029:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141,234,920 (GRCm39)	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141,217,576 (GRCm39)	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141,226,356 (GRCm39)	intron	probably benign
R4509:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141,230,489 (GRCm39)	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141,224,212 (GRCm39)	intron	probably benign
R4678:Muc6	UTSW	7	141,230,554 (GRCm39)	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4737:Muc6	UTSW	7	141,226,426 (GRCm39)	intron	probably benign
R4981:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5012:Muc6	UTSW	7	141,216,570 (GRCm39)	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	probably benign
R5027:Muc6	UTSW	7	141,216,349 (GRCm39)	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141,230,491 (GRCm39)	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5179:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141,237,375 (GRCm39)	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141,217,836 (GRCm39)	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141,235,078 (GRCm39)	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141,216,448 (GRCm39)	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141,235,850 (GRCm39)	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141,226,690 (GRCm39)	splice site	probably benign
R5808:Muc6	UTSW	7	141,226,360 (GRCm39)	intron	probably benign
R5865:Muc6	UTSW	7	141,236,769 (GRCm39)	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141,227,837 (GRCm39)	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141,234,640 (GRCm39)	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141,226,792 (GRCm39)	missense	probably benign
R6236:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141,235,086 (GRCm39)	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141,237,380 (GRCm39)	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141,224,032 (GRCm39)	intron	probably benign
R6609:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6610:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6611:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6623:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6626:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6817:Muc6	UTSW	7	141,237,326 (GRCm39)	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141,217,453 (GRCm39)	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141,226,246 (GRCm39)	intron	probably benign
R7001:Muc6	UTSW	7	141,217,320 (GRCm39)	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141,226,456 (GRCm39)	intron	probably benign
R7097:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7099:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7101:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7107:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7108:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7112:Muc6	UTSW	7	141,235,542 (GRCm39)	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7204:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7205:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7222:Muc6	UTSW	7	141,214,428 (GRCm39)	missense	unknown
R7230:Muc6	UTSW	7	141,235,479 (GRCm39)	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141,226,842 (GRCm39)	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141,224,245 (GRCm39)	missense	unknown
R7501:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141,216,454 (GRCm39)	missense	unknown
R7641:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7644:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141,234,923 (GRCm39)	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141,216,973 (GRCm39)	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7679:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141,237,322 (GRCm39)	splice site	probably null
R7806:Muc6	UTSW	7	141,217,387 (GRCm39)	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141,226,638 (GRCm39)	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141,232,188 (GRCm39)	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141,231,687 (GRCm39)	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141,231,748 (GRCm39)	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141,226,729 (GRCm39)	missense	unknown
R8130:Muc6	UTSW	7	141,233,354 (GRCm39)	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141,235,673 (GRCm39)	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	unknown
R8294:Muc6	UTSW	7	141,217,263 (GRCm39)	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141,226,525 (GRCm39)	missense	unknown
R8537:Muc6	UTSW	7	141,234,184 (GRCm39)	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141,228,439 (GRCm39)	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141,229,549 (GRCm39)	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141,233,791 (GRCm39)	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141,217,018 (GRCm39)	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141,226,351 (GRCm39)	missense	unknown
R9023:Muc6	UTSW	7	141,237,432 (GRCm39)	nonsense	probably null
R9058:Muc6	UTSW	7	141,218,154 (GRCm39)	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141,226,738 (GRCm39)	missense	unknown
R9495:Muc6	UTSW	7	141,237,398 (GRCm39)	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141,216,310 (GRCm39)	missense	unknown
R9787:Muc6	UTSW	7	141,227,748 (GRCm39)	nonsense	probably null
R9788:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141,237,964 (GRCm39)	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141,237,656 (GRCm39)	missense	probably benign	0.20
Z1177:Muc6	UTSW	7	141,236,701 (GRCm39)	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141,217,827 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GCAGAAGAGTGGATCTGTGTAC -3'
(R):5'- GGAATTACCCCAGAAGCCTCTC -3'

Sequencing Primer
(F):5'- AACGCATTATGGATCGTTGTC -3'
(R):5'- AGGAACCAGGCTGTACCC -3'

Posted On

2020-09-02