Incidental Mutation 'R0002:Nuak1'
ID64841
Institutional Source Beutler Lab
Gene Symbol Nuak1
Ensembl Gene ENSMUSG00000020032
Gene NameNUAK family, SNF1-like kinase, 1
Synonyms
MMRRC Submission 038298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0002 (G1)
Quality Score123
Status Validated
Chromosome10
Chromosomal Location84370905-84440597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84375367 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 286 (W286R)
Ref Sequence ENSEMBL: ENSMUSP00000020220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020220]
Predicted Effect probably damaging
Transcript: ENSMUST00000020220
AA Change: W286R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020220
Gene: ENSMUSG00000020032
AA Change: W286R

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
S_TKc 56 307 2.3e-105 SMART
low complexity region 475 490 N/A INTRINSIC
low complexity region 559 589 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129355
AA Change: W136R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122927
Gene: ENSMUSG00000020032
AA Change: W136R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 156 3.1e-19 PFAM
Pfam:Pkinase 19 158 3.5e-38 PFAM
Meta Mutation Damage Score 0.1645 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene die perinatally displaying omphalocele with a failure in closure of the secondary body wall. No gross morphological defects are detected in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik A T 9: 36,637,359 D59E probably damaging Het
Bcl2 T C 1: 106,712,511 R124G possibly damaging Het
Catsper1 A G 19: 5,341,523 probably benign Het
Ccdc125 C T 13: 100,693,606 Q295* probably null Het
Cdhr5 G T 7: 141,270,020 probably null Het
Dhx36 A C 3: 62,480,839 L625W probably damaging Het
Icam5 T A 9: 21,033,505 D121E probably benign Het
Ncoa1 A G 12: 4,290,885 V849A probably benign Het
Prkag3 T C 1: 74,744,788 D312G probably damaging Het
Sbk3 T C 7: 4,970,631 D17G probably damaging Het
Slc26a5 T A 5: 21,814,983 I530F probably damaging Het
Spink12 T C 18: 44,107,696 C50R probably damaging Het
Sult3a2 T C 10: 33,779,807 I59V possibly damaging Het
Tapbp C T 17: 33,925,632 A234V probably damaging Het
Tnr T C 1: 159,874,200 Y624H probably damaging Het
Zfp560 T C 9: 20,347,517 Y683C probably damaging Het
Other mutations in Nuak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nuak1 APN 10 84375134 missense probably damaging 1.00
IGL01374:Nuak1 APN 10 84374668 missense probably damaging 0.96
IGL02967:Nuak1 APN 10 84440221 missense probably damaging 1.00
IGL03207:Nuak1 APN 10 84440129 missense possibly damaging 0.84
R0277:Nuak1 UTSW 10 84374451 missense probably benign 0.02
R0749:Nuak1 UTSW 10 84374784 missense probably damaging 1.00
R0906:Nuak1 UTSW 10 84375280 missense probably damaging 1.00
R1227:Nuak1 UTSW 10 84440309 missense probably benign
R1367:Nuak1 UTSW 10 84392328 splice site probably benign
R1778:Nuak1 UTSW 10 84374874 unclassified probably null
R2151:Nuak1 UTSW 10 84409645 missense probably benign 0.00
R2877:Nuak1 UTSW 10 84375345 missense possibly damaging 0.79
R3863:Nuak1 UTSW 10 84378087 splice site probably null
R4386:Nuak1 UTSW 10 84394044 missense probably damaging 1.00
R4849:Nuak1 UTSW 10 84375279 missense probably damaging 1.00
R4962:Nuak1 UTSW 10 84375115 missense probably damaging 1.00
R5118:Nuak1 UTSW 10 84374984 missense probably benign 0.04
R5134:Nuak1 UTSW 10 84374350 missense probably benign 0.01
R5248:Nuak1 UTSW 10 84409678 missense probably damaging 1.00
R5590:Nuak1 UTSW 10 84375255 missense probably benign
R5719:Nuak1 UTSW 10 84409720 missense probably damaging 1.00
R5933:Nuak1 UTSW 10 84374802 missense probably damaging 0.99
R7067:Nuak1 UTSW 10 84440294 missense possibly damaging 0.59
R7169:Nuak1 UTSW 10 84374745 missense probably damaging 1.00
R7342:Nuak1 UTSW 10 84374967 missense probably damaging 1.00
R7549:Nuak1 UTSW 10 84374539 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCCAATCGATGATCCGTGCC -3'
(R):5'- CATGAAGCTGGAACACTCCAAATGC -3'

Sequencing Primer
(F):5'- TCGATGATCCGTGCCAAGAG -3'
(R):5'- tctttctttctttctttcttccttcc -3'
Posted On2013-08-06