Incidental Mutation 'R7940:Smok2b'
ID649027
Institutional Source Beutler Lab
Gene Symbol Smok2b
Ensembl Gene ENSMUSG00000073457
Gene Namesperm motility kinase 2B
SynonymsLOC236574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7940 (G1)
Quality Score137.008
Status Validated
Chromosome17
Chromosomal Location13230257-13237184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13236159 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 402 (H402L)
Ref Sequence ENSEMBL: ENSMUSP00000124967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059824] [ENSMUST00000162940]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059824
AA Change: H402L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061516
Gene: ENSMUSG00000073457
AA Change: H402L

DomainStartEndE-ValueType
S_TKc 8 256 3.13e-98 SMART
low complexity region 393 405 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162940
AA Change: H402L

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124967
Gene: ENSMUSG00000073457
AA Change: H402L

DomainStartEndE-ValueType
S_TKc 8 256 3.13e-98 SMART
low complexity region 393 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,351,038 M238T probably benign Het
Acacb C T 5: 114,166,047 S177F possibly damaging Het
Afap1l2 A G 19: 56,914,165 V822A probably damaging Het
Akap2 A G 4: 57,883,026 K790E probably damaging Het
Alpk3 C T 7: 81,093,945 P1170L probably damaging Het
Aox3 A G 1: 58,188,437 I1234V probably damaging Het
Ascc1 G A 10: 60,012,559 V103M probably null Het
Brca2 C G 5: 150,538,733 T654S probably benign Het
Cblb T C 16: 52,152,536 F410S probably damaging Het
Cep95 T A 11: 106,796,148 N94K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cpe T A 8: 64,594,911 S440C probably damaging Het
Cspg4 C T 9: 56,888,097 Q1039* probably null Het
Cul5 A T 9: 53,623,769 S612T probably benign Het
Dapl1 T C 2: 59,484,768 probably null Het
Deptor C T 15: 55,208,848 T241M probably benign Het
Dnaaf1 A G 8: 119,582,715 T181A possibly damaging Het
Dnajc11 G T 4: 151,968,588 Q156H probably benign Het
Dst T C 1: 34,167,676 V975A possibly damaging Het
Elf3 T A 1: 135,257,128 S107C probably damaging Het
Enpp2 T A 15: 54,906,928 D105V probably damaging Het
Fam122a G A 19: 24,477,188 R57W probably benign Het
Fgd6 G A 10: 94,120,482 V1008I probably benign Het
Frmpd2 C T 14: 33,554,893 R1157* probably null Het
Gabrg2 A C 11: 41,967,647 V218G probably benign Het
Gdpgp1 C T 7: 80,239,205 A328V probably damaging Het
Glis1 C G 4: 107,632,374 F719L probably damaging Het
Glis1 A T 4: 107,632,375 N720Y probably damaging Het
Grin2c G T 11: 115,255,281 A546D probably damaging Het
Gtf3c5 G A 2: 28,568,580 T433I possibly damaging Het
Jmjd6 C A 11: 116,843,229 probably benign Het
Kctd14 T C 7: 97,457,684 S49P probably damaging Het
Lamc2 T A 1: 153,130,775 K877* probably null Het
Lgr4 T A 2: 110,006,513 S397R probably damaging Het
Lrp2 A T 2: 69,432,197 I4420N possibly damaging Het
Lyn A G 4: 3,783,089 K441E possibly damaging Het
Minpp1 A T 19: 32,485,959 S7C possibly damaging Het
Mrps9 T A 1: 42,862,648 D105E probably damaging Het
Ncoa1 C A 12: 4,313,095 A247S possibly damaging Het
Olfr548-ps1 G A 7: 102,542,308 R124H possibly damaging Het
Olfr893 T C 9: 38,209,200 V47A probably benign Het
Pcdh15 G A 10: 74,594,190 V1250I probably damaging Het
Pcdha12 A T 18: 37,020,356 T43S probably damaging Het
Pkn2 G A 3: 142,810,719 R549C probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Polq T A 16: 37,060,642 M1056K probably benign Het
Ppp1r12b A T 1: 134,876,055 N455K probably benign Het
Rhbdf1 T A 11: 32,216,258 M1L possibly damaging Het
Rspry1 G T 8: 94,623,007 V8L probably benign Het
Slc6a20b A G 9: 123,607,601 V249A probably damaging Het
Supt20 A T 3: 54,713,199 N393I probably benign Het
Tcp11l1 T C 2: 104,698,648 K102E probably damaging Het
Tpbgl T C 7: 99,625,591 Y353C probably damaging Het
Usp24 A T 4: 106,430,544 Q2465L probably damaging Het
Vmn2r116 T A 17: 23,386,972 M286K probably damaging Het
Wnt16 C A 6: 22,291,189 N205K possibly damaging Het
Xkr7 C A 2: 153,032,215 F67L probably damaging Het
Zfp473 T G 7: 44,734,576 E111A probably damaging Het
Zfp74 T C 7: 29,932,442 K126E probably benign Het
Other mutations in Smok2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1442:Smok2b UTSW 17 13235503 missense probably damaging 0.99
R5087:Smok2b UTSW 17 13235124 missense probably benign 0.03
R5538:Smok2b UTSW 17 13235553 missense possibly damaging 0.72
R5704:Smok2b UTSW 17 13236344 missense probably damaging 1.00
R6978:Smok2b UTSW 17 13236408 makesense probably null
R7598:Smok2b UTSW 17 13236086 nonsense probably null
R7701:Smok2b UTSW 17 13234880 start gained probably benign
R8211:Smok2b UTSW 17 13235793 missense probably benign 0.00
R8483:Smok2b UTSW 17 13235021 missense probably benign
R8957:Smok2b UTSW 17 13234986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGGACTTCGGAGGAG -3'
(R):5'- TTGGGGAGACTCTACTGTGC -3'

Sequencing Primer
(F):5'- GAGAGACTGAACCCACGAGTCTC -3'
(R):5'- TGGGATACAGCAACAGAGCTTCC -3'
Posted On2020-09-15