Incidental Mutation 'R7942:Trcg1'
ID649113
Institutional Source Beutler Lab
Gene Symbol Trcg1
Ensembl Gene ENSMUSG00000070298
Gene Nametaste receptor cell gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7942 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57236556-57249864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57242216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000091357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093837]
Predicted Effect probably benign
Transcript: ENSMUST00000093837
AA Change: V357A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091357
Gene: ENSMUSG00000070298
AA Change: V357A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
Blast:SEA 449 549 5e-21 BLAST
low complexity region 580 594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A G 8: 11,655,615 I164T unknown Het
Abcg3 A G 5: 104,939,161 I565T probably damaging Het
Adamts8 G A 9: 30,953,482 C423Y probably damaging Het
Adamts8 G A 9: 30,958,913 probably null Het
Ahctf1 A C 1: 179,786,095 V490G possibly damaging Het
Akap13 A G 7: 75,611,470 T478A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ano9 T C 7: 141,104,076 S559G probably damaging Het
Aox2 A G 1: 58,337,431 T924A probably damaging Het
Atp13a1 A G 8: 69,807,220 E1126G probably damaging Het
Bcan A G 3: 87,993,075 V617A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldnd1 A T 16: 58,729,715 N87I possibly damaging Het
Enpp2 A T 15: 54,845,879 V784E probably damaging Het
Eps8 T A 6: 137,530,577 Y51F possibly damaging Het
Fam184b T C 5: 45,584,253 K212R probably benign Het
Fbn1 A C 2: 125,412,786 C186G possibly damaging Het
Fsip1 G A 2: 118,136,611 T411I probably benign Het
Glyr1 T C 16: 5,018,921 T460A probably benign Het
Gm19410 G A 8: 35,771,786 G70R probably damaging Het
Gna15 G A 10: 81,523,911 T15I probably damaging Het
Heg1 T C 16: 33,751,200 C1198R probably damaging Het
Hoxd1 A G 2: 74,764,160 Y253C probably damaging Het
Il17re G T 6: 113,466,150 Q316H probably damaging Het
Jakmip1 C A 5: 37,173,838 P621T probably benign Het
Krt71 T C 15: 101,735,459 Y448C probably damaging Het
Lgals8 A G 13: 12,453,256 probably null Het
March11 A G 15: 26,409,419 *401W probably null Het
Mctp1 A T 13: 76,641,710 probably null Het
Mms19 C A 19: 41,955,961 V310F probably damaging Het
Mycbp2 A T 14: 103,155,238 F3296I probably damaging Het
Myo7b A T 18: 32,013,369 I121N probably damaging Het
Nr0b2 T C 4: 133,553,536 S38P probably benign Het
Nudt16l1 T A 16: 4,939,379 M52K probably benign Het
Olfr1079 T C 2: 86,538,222 N229S probably benign Het
Olfr399 A G 11: 74,054,228 I177T probably damaging Het
Polr3gl A T 3: 96,582,236 probably null Het
Ptch2 T A 4: 117,106,001 F228L probably benign Het
Slc35d1 A G 4: 103,213,163 probably null Het
Slc41a1 G A 1: 131,840,897 V198I probably damaging Het
Slc5a7 T C 17: 54,276,681 D527G possibly damaging Het
Spag16 G T 1: 69,827,088 A29S probably benign Het
Speer4f2 T A 5: 17,377,632 D284E unknown Het
Sspo A G 6: 48,488,500 probably null Het
Tdpoz1 T C 3: 93,671,210 K89R possibly damaging Het
Tek C T 4: 94,851,874 probably null Het
Tet3 C T 6: 83,376,974 V902M probably damaging Het
Tpcn2 C T 7: 145,257,191 V590M probably damaging Het
Tspan18 A G 2: 93,210,858 V133A probably benign Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Vmn2r95 T A 17: 18,440,267 L314I possibly damaging Het
Wdsub1 G A 2: 59,876,717 A178V probably damaging Het
Zfp407 A G 18: 84,559,629 S1120P probably benign Het
Zfp57 T C 17: 37,009,674 F140S probably damaging Het
Other mutations in Trcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Trcg1 APN 9 57242273 missense probably benign
IGL01727:Trcg1 APN 9 57242594 missense probably damaging 0.97
IGL02147:Trcg1 APN 9 57245849 missense probably benign 0.20
IGL02329:Trcg1 APN 9 57240393 missense possibly damaging 0.92
IGL02658:Trcg1 APN 9 57242228 nonsense probably null
IGL02852:Trcg1 APN 9 57241312 missense possibly damaging 0.94
IGL03163:Trcg1 APN 9 57248347 missense possibly damaging 0.92
FR4589:Trcg1 UTSW 9 57242202 frame shift probably null
R0555:Trcg1 UTSW 9 57242333 missense probably damaging 1.00
R0747:Trcg1 UTSW 9 57241921 missense probably benign 0.00
R1061:Trcg1 UTSW 9 57245873 missense possibly damaging 0.66
R1521:Trcg1 UTSW 9 57242465 missense probably benign 0.36
R1622:Trcg1 UTSW 9 57248672 missense possibly damaging 0.94
R1652:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R4677:Trcg1 UTSW 9 57245861 missense possibly damaging 0.94
R4879:Trcg1 UTSW 9 57246720 missense probably damaging 0.99
R5013:Trcg1 UTSW 9 57242279 missense probably damaging 0.99
R5141:Trcg1 UTSW 9 57241304 missense probably damaging 1.00
R5690:Trcg1 UTSW 9 57241811 missense probably benign 0.36
R6416:Trcg1 UTSW 9 57241330 missense possibly damaging 0.46
R6980:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R7022:Trcg1 UTSW 9 57241569 missense possibly damaging 0.46
R7172:Trcg1 UTSW 9 57248335 missense probably benign 0.01
R7276:Trcg1 UTSW 9 57242579 missense probably damaging 0.99
R7412:Trcg1 UTSW 9 57241483 missense probably benign 0.00
R7546:Trcg1 UTSW 9 57248338 missense probably benign 0.34
R8087:Trcg1 UTSW 9 57248674 missense probably damaging 0.99
R8094:Trcg1 UTSW 9 57242281 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTATCCCGTGGTACTTCTGTG -3'
(R):5'- CAGATGACTCTGTGAAGCCAG -3'

Sequencing Primer
(F):5'- GTGCTGCTGTTGCCCTCAG -3'
(R):5'- CAGAGCTATGTGCGGTA -3'
Posted On2020-09-15