Incidental Mutation 'R7942:Abcg3'
ID 649101
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Mxr2, Abcp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R7942 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 104935057-104982718 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104939161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 565 (I565T)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: I565T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: I565T

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130644
AA Change: I535T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: I535T

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A G 8: 11,655,615 I164T unknown Het
Adamts8 G A 9: 30,953,482 C423Y probably damaging Het
Adamts8 G A 9: 30,958,913 probably null Het
Ahctf1 A C 1: 179,786,095 V490G possibly damaging Het
Akap13 A G 7: 75,611,470 T478A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ano9 T C 7: 141,104,076 S559G probably damaging Het
Aox2 A G 1: 58,337,431 T924A probably damaging Het
Atp13a1 A G 8: 69,807,220 E1126G probably damaging Het
Bcan A G 3: 87,993,075 V617A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldnd1 A T 16: 58,729,715 N87I possibly damaging Het
Enpp2 A T 15: 54,845,879 V784E probably damaging Het
Eps8 T A 6: 137,530,577 Y51F possibly damaging Het
Fam184b T C 5: 45,584,253 K212R probably benign Het
Fbn1 A C 2: 125,412,786 C186G possibly damaging Het
Fsip1 G A 2: 118,136,611 T411I probably benign Het
Glyr1 T C 16: 5,018,921 T460A probably benign Het
Gm19410 G A 8: 35,771,786 G70R probably damaging Het
Gna15 G A 10: 81,523,911 T15I probably damaging Het
Heg1 T C 16: 33,751,200 C1198R probably damaging Het
Hoxd1 A G 2: 74,764,160 Y253C probably damaging Het
Il17re G T 6: 113,466,150 Q316H probably damaging Het
Jakmip1 C A 5: 37,173,838 P621T probably benign Het
Krt71 T C 15: 101,735,459 Y448C probably damaging Het
Lgals8 A G 13: 12,453,256 probably null Het
March11 A G 15: 26,409,419 *401W probably null Het
Mctp1 A T 13: 76,641,710 probably null Het
Mms19 C A 19: 41,955,961 V310F probably damaging Het
Mycbp2 A T 14: 103,155,238 F3296I probably damaging Het
Myo7b A T 18: 32,013,369 I121N probably damaging Het
Nr0b2 T C 4: 133,553,536 S38P probably benign Het
Nudt16l1 T A 16: 4,939,379 M52K probably benign Het
Olfr1079 T C 2: 86,538,222 N229S probably benign Het
Olfr399 A G 11: 74,054,228 I177T probably damaging Het
Polr3gl A T 3: 96,582,236 probably null Het
Ptch2 T A 4: 117,106,001 F228L probably benign Het
Slc35d1 A G 4: 103,213,163 probably null Het
Slc41a1 G A 1: 131,840,897 V198I probably damaging Het
Slc5a7 T C 17: 54,276,681 D527G possibly damaging Het
Spag16 G T 1: 69,827,088 A29S probably benign Het
Speer4f2 T A 5: 17,377,632 D284E unknown Het
Sspo A G 6: 48,488,500 probably null Het
Tdpoz1 T C 3: 93,671,210 K89R possibly damaging Het
Tek C T 4: 94,851,874 probably null Het
Tet3 C T 6: 83,376,974 V902M probably damaging Het
Tpcn2 C T 7: 145,257,191 V590M probably damaging Het
Trcg1 T C 9: 57,242,216 V357A probably benign Het
Tspan18 A G 2: 93,210,858 V133A probably benign Het
Unc5b A T 10: 60,777,543 W305R probably damaging Het
Vmn2r95 T A 17: 18,440,267 L314I possibly damaging Het
Wdsub1 G A 2: 59,876,717 A178V probably damaging Het
Zfp407 A G 18: 84,559,629 S1120P probably benign Het
Zfp57 T C 17: 37,009,674 F140S probably damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4242:Abcg3 UTSW 5 104961213 missense probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5309:Abcg3 UTSW 5 104936599 missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6309:Abcg3 UTSW 5 104969393 critical splice donor site probably null
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6872:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
R7531:Abcg3 UTSW 5 104977641 missense probably benign
R7685:Abcg3 UTSW 5 104968215 missense probably damaging 1.00
R7728:Abcg3 UTSW 5 104936078 missense probably benign 0.00
R7819:Abcg3 UTSW 5 104977728 missense probably benign 0.05
R8059:Abcg3 UTSW 5 104953082 critical splice donor site probably null
R9181:Abcg3 UTSW 5 104974096 missense probably benign
R9529:Abcg3 UTSW 5 104974107 missense probably damaging 1.00
R9641:Abcg3 UTSW 5 104936617 missense probably benign
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACTTACTGACCATAGGC -3'
(R):5'- GAACCTTGGCATTGACAAGAG -3'

Sequencing Primer
(F):5'- CTTACTGACCATAGGCTAAGTAAAAC -3'
(R):5'- CCTTGGCATTGACAAGAGTAAAGAC -3'
Posted On 2020-09-15