Incidental Mutation 'R7954:Olfr470'
ID649719
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R7954 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107844912 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 274 (N274D)
Ref Sequence ENSEMBL: ENSMUSP00000151543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: N274D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: N274D

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220193
AA Change: N274D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,343 C409Y possibly damaging Het
Acsm2 C T 7: 119,580,729 T390I probably damaging Het
Adam20 T C 8: 40,796,544 Y564H probably damaging Het
Adcy6 A G 15: 98,596,892 probably null Het
Alms1 T C 6: 85,621,162 V990A probably damaging Het
Anapc2 T A 2: 25,274,700 V318E probably damaging Het
Ano6 G T 15: 95,965,821 A741S possibly damaging Het
Apc A G 18: 34,314,268 S1406G probably damaging Het
Cfi G A 3: 129,868,585 probably null Het
Clcn1 A T 6: 42,286,691 probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Dnmbp A T 19: 43,902,303 W342R probably benign Het
Dok5 T A 2: 170,833,073 probably null Het
Dusp27 C T 1: 166,099,280 S921N probably benign Het
Eno3 T C 11: 70,661,180 I284T probably benign Het
Ep400 T C 5: 110,668,733 T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 V162A probably damaging Het
Fam208a T C 14: 27,447,524 probably null Het
Fat3 A G 9: 15,998,412 I2098T probably damaging Het
Fbxl13 T C 5: 21,543,769 N384S probably benign Het
Fbxo9 A G 9: 78,101,544 L78P probably benign Het
Glis1 G A 4: 107,619,657 R525H possibly damaging Het
Gpr15 T G 16: 58,718,684 D14A probably benign Het
Gpr156 T C 16: 37,987,558 I189T probably damaging Het
H6pd T C 4: 149,982,826 I376V probably benign Het
Hs6st3 T C 14: 119,869,110 V310A probably damaging Het
Htr1b A G 9: 81,631,945 L203P probably damaging Het
Kif26b A T 1: 178,869,379 I531F probably damaging Het
Krtcap3 T C 5: 31,252,671 L166P probably damaging Het
Lmod1 A C 1: 135,325,056 D16A probably damaging Het
Lrp2 T G 2: 69,503,523 N1458T possibly damaging Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Nop14 G A 5: 34,650,385 P411L probably benign Het
Nr2f1 A C 13: 78,189,994 D334E probably damaging Het
Olfr1043 A G 2: 86,162,868 L27P probably damaging Het
Paqr9 G A 9: 95,560,628 V224M probably damaging Het
Pkd2l1 T C 19: 44,154,212 T464A probably benign Het
Prss58 T C 6: 40,895,609 R188G possibly damaging Het
Rapgef2 G A 3: 79,070,147 R1150* probably null Het
Rgs22 A C 15: 36,082,002 F653V possibly damaging Het
Spata2 T C 2: 167,483,937 T321A probably benign Het
St3gal1 A T 15: 67,112,573 F118I probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tll1 G A 8: 64,118,534 T171I probably damaging Het
Tmem2 T A 19: 21,792,900 I84N probably damaging Het
Umodl1 A T 17: 30,986,387 Q652L probably benign Het
Usp54 A G 14: 20,561,913 L945P probably benign Het
Vars A G 17: 35,015,984 H1263R probably benign Het
Vmn1r202 A T 13: 22,501,701 M182K probably benign Het
Vmn1r78 T A 7: 12,153,300 C279* probably null Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R2441:Olfr470 UTSW 7 107844978 missense probably benign 0.10
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R5874:Olfr470 UTSW 7 107845170 missense probably benign
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R6820:Olfr470 UTSW 7 107845091 missense probably benign 0.01
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
R8215:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R8255:Olfr470 UTSW 7 107845161 missense probably damaging 1.00
R8384:Olfr470 UTSW 7 107845258 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGAACATATATTTCAGCCACAGG -3'
(R):5'- TCACAGTGTCTGTCATAGCCATC -3'

Sequencing Primer
(F):5'- GTGTCTGTCTGTAGGATGTTATTAC -3'
(R):5'- AGTGTCTGTCATAGCCATCTCCTAC -3'
Posted On2020-09-15