Incidental Mutation 'R7954:Umodl1'
ID 649741
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7954 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30986387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 652 (Q652L)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably benign
Transcript: ENSMUST00000066554
AA Change: Q652L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Q652L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066981
AA Change: Q623L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Q623L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114555
AA Change: Q652L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Q652L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,012,343 C409Y possibly damaging Het
Acsm2 C T 7: 119,580,729 T390I probably damaging Het
Adam20 T C 8: 40,796,544 Y564H probably damaging Het
Adcy6 A G 15: 98,596,892 probably null Het
Alms1 T C 6: 85,621,162 V990A probably damaging Het
Anapc2 T A 2: 25,274,700 V318E probably damaging Het
Ano6 G T 15: 95,965,821 A741S possibly damaging Het
Apc A G 18: 34,314,268 S1406G probably damaging Het
Cfi G A 3: 129,868,585 probably null Het
Clcn1 A T 6: 42,286,691 probably benign Het
Crygs C T 16: 22,805,332 R175H probably damaging Het
Dnmbp A T 19: 43,902,303 W342R probably benign Het
Dok5 T A 2: 170,833,073 probably null Het
Dusp27 C T 1: 166,099,280 S921N probably benign Het
Eno3 T C 11: 70,661,180 I284T probably benign Het
Ep400 T C 5: 110,668,733 T2767A possibly damaging Het
Epb41l4b A G 4: 57,088,034 V162A probably damaging Het
Fam208a T C 14: 27,447,524 probably null Het
Fat3 A G 9: 15,998,412 I2098T probably damaging Het
Fbxl13 T C 5: 21,543,769 N384S probably benign Het
Fbxo9 A G 9: 78,101,544 L78P probably benign Het
Glis1 G A 4: 107,619,657 R525H possibly damaging Het
Gpr15 T G 16: 58,718,684 D14A probably benign Het
Gpr156 T C 16: 37,987,558 I189T probably damaging Het
H6pd T C 4: 149,982,826 I376V probably benign Het
Hs6st3 T C 14: 119,869,110 V310A probably damaging Het
Htr1b A G 9: 81,631,945 L203P probably damaging Het
Kif26b A T 1: 178,869,379 I531F probably damaging Het
Krtcap3 T C 5: 31,252,671 L166P probably damaging Het
Lmod1 A C 1: 135,325,056 D16A probably damaging Het
Lrp2 T G 2: 69,503,523 N1458T possibly damaging Het
Mocs1 G A 17: 49,454,771 G631E possibly damaging Het
Nop14 G A 5: 34,650,385 P411L probably benign Het
Nr2f1 A C 13: 78,189,994 D334E probably damaging Het
Olfr1043 A G 2: 86,162,868 L27P probably damaging Het
Olfr470 T C 7: 107,844,912 N274D probably benign Het
Paqr9 G A 9: 95,560,628 V224M probably damaging Het
Pkd2l1 T C 19: 44,154,212 T464A probably benign Het
Prss58 T C 6: 40,895,609 R188G possibly damaging Het
Rapgef2 G A 3: 79,070,147 R1150* probably null Het
Rgs22 A C 15: 36,082,002 F653V possibly damaging Het
Spata2 T C 2: 167,483,937 T321A probably benign Het
St3gal1 A T 15: 67,112,573 F118I probably damaging Het
Tex35 C T 1: 157,100,172 D143N probably damaging Het
Tll1 G A 8: 64,118,534 T171I probably damaging Het
Tmem2 T A 19: 21,792,900 I84N probably damaging Het
Usp54 A G 14: 20,561,913 L945P probably benign Het
Vars A G 17: 35,015,984 H1263R probably benign Het
Vmn1r202 A T 13: 22,501,701 M182K probably benign Het
Vmn1r78 T A 7: 12,153,300 C279* probably null Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9270:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 30996393 missense probably damaging 0.99
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCACCGAGTCACTAAGTTCC -3'
(R):5'- CGAGGGTCTTCATTCTGTAGTC -3'

Sequencing Primer
(F):5'- GTTCCAAGCACCCAAGGAG -3'
(R):5'- CTTCATTCTGTAGTCTTGTGGAGTTC -3'
Posted On 2020-09-15