Incidental Mutation 'R7960:1110004F10Rik'
ID 650059
Institutional Source Beutler Lab
Gene Symbol 1110004F10Rik
Ensembl Gene ENSMUSG00000030663
Gene Name RIKEN cDNA 1110004F10 gene
Synonyms sid2057
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R7960 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 116039397-116105210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116103246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000032899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032899] [ENSMUST00000106607] [ENSMUST00000106608] [ENSMUST00000151254] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold Q9R0P4
Predicted Effect possibly damaging
Transcript: ENSMUST00000032899
AA Change: S82P

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032899
Gene: ENSMUSG00000030663
AA Change: S82P

DomainStartEndE-ValueType
Pfam:SMAP 27 103 1.1e-17 PFAM
low complexity region 105 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106607
SMART Domains Protein: ENSMUSP00000102218
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
low complexity region 18 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106608
AA Change: S38P

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102219
Gene: ENSMUSG00000030663
AA Change: S38P

DomainStartEndE-ValueType
Pfam:SMAP 1 59 7.8e-10 PFAM
low complexity region 61 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151254
SMART Domains Protein: ENSMUSP00000116035
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
Pfam:SMAP 26 79 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect possibly damaging
Transcript: ENSMUST00000205450
AA Change: S38P

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
G6pc G A 11: 101,376,533 G270R probably damaging Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Pole A G 5: 110,289,861 K95R possibly damaging Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Slc8a3 C T 12: 81,216,732 S627N probably benign Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sri A T 5: 8,064,586 Q180H probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in 1110004F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2391:1110004F10Rik UTSW 7 116104226 missense probably damaging 0.99
R4789:1110004F10Rik UTSW 7 116093522 missense probably benign 0.03
R6249:1110004F10Rik UTSW 7 116103270 missense probably damaging 1.00
R6802:1110004F10Rik UTSW 7 116099490 missense probably damaging 1.00
R8509:1110004F10Rik UTSW 7 116104434 missense possibly damaging 0.83
R9063:1110004F10Rik UTSW 7 116104425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACAATGCAATATGAAGTCAGTC -3'
(R):5'- GTAGCTGACAAGAAAGCACTCTC -3'

Sequencing Primer
(F):5'- GTCAGTCAGTTAGAGACCTCAGC -3'
(R):5'- GGATACACAGTGAAACCCTGTCTTG -3'
Posted On 2020-09-15