Incidental Mutation 'R7965:Skint2'
ID650312
Institutional Source Beutler Lab
Gene Symbol Skint2
Ensembl Gene ENSMUSG00000034359
Gene Nameselection and upkeep of intraepithelial T cells 2
SynonymsB7S3, OTTMUSG00000008540
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7965 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112557194-112652248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112645451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 286 (M286K)
Ref Sequence ENSEMBL: ENSMUSP00000139831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106560] [ENSMUST00000186969]
Predicted Effect probably benign
Transcript: ENSMUST00000106560
AA Change: M286K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102170
Gene: ENSMUSG00000034359
AA Change: M286K

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 1.3e-10 PFAM
Pfam:Ig_2 153 231 2e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186969
AA Change: M286K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139831
Gene: ENSMUSG00000034359
AA Change: M286K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 2e-10 PFAM
Pfam:Ig_2 154 231 1.7e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 322 344 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,658,412 T154A Het
Arhgap21 A G 2: 20,849,196 I1795T probably damaging Het
Arhgef4 T C 1: 34,811,681 V436A probably benign Het
Bche A T 3: 73,701,816 N92K probably damaging Het
Bmp2 C T 2: 133,561,185 H219Y probably benign Het
Cables1 T G 18: 11,840,212 V136G probably benign Het
Cacna1d G A 14: 30,047,313 R1887* probably null Het
Chrd A G 16: 20,739,153 E774G probably benign Het
Chrna2 A G 14: 66,151,076 *513W probably null Het
Cracr2b T C 7: 141,464,248 F131S probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyfip1 T A 7: 55,896,775 I545N possibly damaging Het
Ddx58 C A 4: 40,223,824 G397* probably null Het
Enpp3 T A 10: 24,778,819 T654S possibly damaging Het
Glce A G 9: 62,060,946 S308P probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmmr A C 11: 40,715,429 probably null Het
Hoxb9 A G 11: 96,274,638 N178D probably benign Het
Igkv10-94 A T 6: 68,704,611 F82I probably damaging Het
Igkv1-133 A T 6: 67,725,594 K99* probably null Het
Il4i1 A G 7: 44,840,395 Q528R probably benign Het
Inhba G T 13: 16,026,987 G378V possibly damaging Het
Katna1 T C 10: 7,738,859 S44P probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mgat4d T C 8: 83,358,093 V155A possibly damaging Het
Morc2b C T 17: 33,135,772 E1009K possibly damaging Het
Myo9a T A 9: 59,788,438 L341H probably damaging Het
Nell2 C T 15: 95,231,335 D716N probably damaging Het
Olfr1076 A G 2: 86,508,471 H4R probably benign Het
Olfr1101 A G 2: 86,988,363 V271A probably benign Het
Olfr354 A G 2: 36,906,941 probably benign Het
Olfr957 C T 9: 39,511,514 V69I probably benign Het
Ppp1r37 T C 7: 19,531,943 T633A probably damaging Het
Prdm10 A G 9: 31,347,006 K576E probably damaging Het
Prl2c5 G T 13: 13,185,884 M45I probably benign Het
Rnf44 A G 13: 54,682,854 S247P probably benign Het
Scn3a A G 2: 65,506,211 F684L probably damaging Het
Slc39a9 G A 12: 80,666,676 G116D probably damaging Het
Smchd1 G A 17: 71,455,626 T206I possibly damaging Het
Tmem161a C T 8: 70,177,504 probably benign Het
Trpm6 T A 19: 18,876,110 H1831Q probably damaging Het
Trpm7 A T 2: 126,825,694 H792Q probably damaging Het
Ttc6 A G 12: 57,673,756 Q936R possibly damaging Het
Usp53 A T 3: 122,962,882 probably null Het
Vmn1r236 T A 17: 21,287,434 C271* probably null Het
Vmn2r70 T A 7: 85,561,863 M547L probably damaging Het
Vwa5b1 G A 4: 138,605,489 T254M probably damaging Het
Zc3h4 T C 7: 16,429,845 F655S unknown Het
Zfp605 G A 5: 110,127,450 G145S probably benign Het
Other mutations in Skint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Skint2 APN 4 112624212 missense probably damaging 1.00
IGL00801:Skint2 APN 4 112625991 missense possibly damaging 0.88
IGL01602:Skint2 APN 4 112625994 missense probably benign 0.44
IGL01605:Skint2 APN 4 112625994 missense probably benign 0.44
IGL02015:Skint2 APN 4 112624128 nonsense probably null
IGL02694:Skint2 APN 4 112616595 splice site probably benign
IGL03247:Skint2 APN 4 112626026 missense probably benign 0.06
PIT4677001:Skint2 UTSW 4 112625938 missense probably benign 0.10
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0190:Skint2 UTSW 4 112616532 missense possibly damaging 0.85
R0479:Skint2 UTSW 4 112624041 missense possibly damaging 0.47
R0625:Skint2 UTSW 4 112624086 missense probably damaging 1.00
R1143:Skint2 UTSW 4 112625936 missense probably benign 0.00
R1564:Skint2 UTSW 4 112625998 missense probably damaging 1.00
R1861:Skint2 UTSW 4 112647118 intron probably benign
R1864:Skint2 UTSW 4 112625909 missense probably benign 0.10
R3079:Skint2 UTSW 4 112639673 missense probably benign 0.01
R3891:Skint2 UTSW 4 112624186 missense probably damaging 1.00
R4422:Skint2 UTSW 4 112584588 intron probably benign
R4799:Skint2 UTSW 4 112652108 missense probably benign 0.07
R5458:Skint2 UTSW 4 112624180 missense possibly damaging 0.83
R5482:Skint2 UTSW 4 112625879 missense probably damaging 1.00
R5603:Skint2 UTSW 4 112649764 missense possibly damaging 0.91
R7068:Skint2 UTSW 4 112624351 missense probably damaging 1.00
R7233:Skint2 UTSW 4 112625925 missense probably damaging 0.99
R7335:Skint2 UTSW 4 112624218 missense probably damaging 1.00
R7516:Skint2 UTSW 4 112625971 missense probably damaging 1.00
R7790:Skint2 UTSW 4 112616554 missense possibly damaging 0.71
R7878:Skint2 UTSW 4 112649745 missense possibly damaging 0.85
R7941:Skint2 UTSW 4 112625990 missense probably damaging 1.00
R7976:Skint2 UTSW 4 112624132 missense probably damaging 1.00
R8100:Skint2 UTSW 4 112626000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCTTACACTTGTACACTAACAATG -3'
(R):5'- GGCGCTGGAATCTAGATCTTATAGG -3'

Sequencing Primer
(F):5'- GTACACTAACAATGTACTCTACACAC -3'
(R):5'- AGGTATGCTCTAATGCTTATTGTTCC -3'
Posted On2020-09-15