Incidental Mutation 'R8431:Slc26a5'
ID653741
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8431 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21813906 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 645 (D645A)
Ref Sequence ENSEMBL: ENSMUSP00000030878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect probably damaging
Transcript: ENSMUST00000030878
AA Change: D645A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: D645A

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115176
AA Change: D608A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: D608A

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127975
AA Change: D613A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: D613A

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142888
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 A G 8: 123,968,134 F273S Het
Abhd14b G T 9: 106,451,413 A78S probably benign Het
Adamtsl5 G A 10: 80,345,394 P51L probably benign Het
Adap1 A C 5: 139,273,425 F336V probably benign Het
Ankrd33b T C 15: 31,305,102 N172S probably damaging Het
Arhgap24 A G 5: 102,892,598 E560G possibly damaging Het
Ascc2 A T 11: 4,664,227 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C130026I21Rik G A 1: 85,257,449 H130Y probably benign Het
Card6 A T 15: 5,100,276 F546Y probably damaging Het
Cby3 T G 11: 50,359,257 S2A probably damaging Het
Cct3 T C 3: 88,318,524 S385P possibly damaging Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpne3 C A 4: 19,526,316 A408S probably damaging Het
Ctsr A C 13: 61,160,490 L280R probably damaging Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Dlg4 A G 11: 70,039,562 I388V probably benign Het
Ednrb T A 14: 103,843,197 I94F probably benign Het
Eftud2 C A 11: 102,846,236 A573S probably benign Het
Fsip2 C A 2: 82,981,566 P2743Q probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Ier5 C A 1: 155,098,560 D291Y probably benign Het
Ifi207 T C 1: 173,730,504 I223V unknown Het
Ifi208 T C 1: 173,683,278 V333A possibly damaging Het
Kank4 T C 4: 98,779,272 I313V probably benign Het
Klhl7 T C 5: 24,138,475 V263A possibly damaging Het
Klrg2 T C 6: 38,628,187 D314G probably benign Het
Lrr1 T C 12: 69,178,696 M382T possibly damaging Het
Ly6e A T 15: 74,958,341 Q48L probably benign Het
March6 C T 15: 31,505,746 W43* probably null Het
Mepe A G 5: 104,338,181 T396A possibly damaging Het
Myh8 T G 11: 67,283,614 L229R possibly damaging Het
Ndufa10 C G 1: 92,452,010 probably null Het
Nek1 C A 8: 61,034,032 A272E possibly damaging Het
Nr1h2 T C 7: 44,550,343 Y384C probably damaging Het
Olfr1223 C A 2: 89,144,379 V215F probably benign Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Phf2 A G 13: 48,821,602 F294S unknown Het
Polr3e A T 7: 120,931,305 I173F probably damaging Het
Ppfia2 A T 10: 106,836,091 R464* probably null Het
Ppp1r9a T A 6: 5,115,456 S860T probably benign Het
Rnf144a T C 12: 26,327,301 Y93C probably damaging Het
Ryr2 T C 13: 11,659,008 E3390G probably benign Het
Scn7a T C 2: 66,703,820 T504A possibly damaging Het
Ston2 T A 12: 91,648,297 I446F probably damaging Het
Tcp11l1 G A 2: 104,699,969 P57S probably damaging Het
Th G T 7: 142,893,064 H488Q probably benign Het
Tmprss4 A T 9: 45,184,363 I61N probably benign Het
Wdtc1 A G 4: 133,322,170 probably null Het
Xpnpep1 T C 19: 52,995,506 N596S probably benign Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0136:Slc26a5 UTSW 5 21834347 missense probably damaging 1.00
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1648:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4793:Slc26a5 UTSW 5 21837994 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R5806:Slc26a5 UTSW 5 21823563 missense probably damaging 1.00
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6525:Slc26a5 UTSW 5 21820350 missense possibly damaging 0.77
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6885:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
R7001:Slc26a5 UTSW 5 21811336 missense probably damaging 1.00
R7027:Slc26a5 UTSW 5 21816974 missense possibly damaging 0.60
R7174:Slc26a5 UTSW 5 21813894 missense probably damaging 1.00
R7184:Slc26a5 UTSW 5 21837246 nonsense probably null
R7650:Slc26a5 UTSW 5 21834330 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAACTCAGAGTATCAGCAC -3'
(R):5'- ATTCATGGTCTCATTTTGGTCATAG -3'

Sequencing Primer
(F):5'- TGACATCTAGGACATGCGTC -3'
(R):5'- CTCATTTTGGTCATAGGATGCAGAAG -3'
Posted On2020-10-20