Incidental Mutation 'R8531:Osbpl9'
ID659037
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8531 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109156711 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 62 (D62G)
Ref Sequence ENSEMBL: ENSMUSP00000030288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000159545] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably damaging
Transcript: ENSMUST00000030288
AA Change: D62G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: D62G

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160774
AA Change: D45G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: D45G

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161363
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162787
AA Change: D62G

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: D62G

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194478
AA Change: D62G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: D62G

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,066,421 R1506S probably benign Het
Acox2 T C 14: 8,247,960 T441A probably damaging Het
Adam6a A G 12: 113,545,297 E430G probably damaging Het
Afg3l2 T C 18: 67,407,369 E690G probably damaging Het
Alb A G 5: 90,464,014 I101V probably benign Het
Arhgef19 T C 4: 141,249,592 I493T possibly damaging Het
Btnl2 T C 17: 34,358,054 M61T probably benign Het
Cyp2d11 A G 15: 82,389,228 Y481H probably benign Het
Ddx58 A G 4: 40,225,596 probably null Het
Dennd4c T C 4: 86,826,082 probably null Het
Dhx9 C A 1: 153,458,436 V993F possibly damaging Het
Dlk1 A G 12: 109,458,140 Q110R probably null Het
Dmp1 A C 5: 104,212,403 D315A probably damaging Het
Dnah3 T C 7: 119,951,368 K3243E probably damaging Het
Dsc3 T C 18: 19,968,392 N648S probably benign Het
Dsc3 C T 18: 19,981,217 D327N probably damaging Het
Egr4 T C 6: 85,512,124 D318G probably damaging Het
Fiz1 A T 7: 5,009,164 C118* probably null Het
Flad1 A C 3: 89,403,210 Y479D probably damaging Het
Flnb T C 14: 7,929,939 F2023S probably damaging Het
Glp1r T C 17: 30,924,557 L189P probably damaging Het
Gm13103 T A 4: 143,853,031 D395E probably benign Het
Grm5 A T 7: 88,130,516 T1055S probably benign Het
Gucy1a1 A G 3: 82,111,161 I123T probably benign Het
Ifnar1 T A 16: 91,495,456 C199* probably null Het
Lepr A T 4: 101,765,415 Y464F probably damaging Het
Mamdc4 G T 2: 25,567,718 Q452K possibly damaging Het
Map2k6 A G 11: 110,399,349 probably benign Het
Mphosph10 T C 7: 64,384,328 I429V possibly damaging Het
Neb T A 2: 52,291,062 M1178L possibly damaging Het
Npc2 C A 12: 84,760,838 R82L probably benign Het
Olfm5 A T 7: 104,153,822 M478K probably benign Het
Olfr1109 G T 2: 87,093,326 Q24K probably benign Het
Olfr177 A C 16: 58,872,653 L166V probably damaging Het
Otog C T 7: 46,252,049 R391C probably damaging Het
Pdzd3 T C 9: 44,248,373 E442G probably damaging Het
Plppr4 T C 3: 117,321,943 Y755C probably damaging Het
Pnpla8 T A 12: 44,311,585 F708I possibly damaging Het
Pom121l12 A T 11: 14,599,932 T213S probably benign Het
Rabep1 T C 11: 70,908,506 S278P probably benign Het
Rnf213 C G 11: 119,474,205 Q4563E probably benign Het
Rttn C A 18: 89,113,343 R1949S probably benign Het
Rwdd3 T C 3: 121,159,139 I140V probably benign Het
Serpinb6a A T 13: 33,931,479 M53K probably damaging Het
Serpinb9g A T 13: 33,492,913 D226V possibly damaging Het
Serpind1 A T 16: 17,342,983 Y459F probably damaging Het
Skor2 T C 18: 76,858,874 V97A unknown Het
Slc26a4 C T 12: 31,549,912 probably null Het
Slc4a10 T C 2: 62,267,507 Y517H probably damaging Het
Sphkap A G 1: 83,277,188 W947R probably damaging Het
Sult3a2 T C 10: 33,777,243 D167G probably damaging Het
Supt16 A T 14: 52,172,563 M729K probably damaging Het
Tmem176b A G 6: 48,834,604 I37T possibly damaging Het
Tmem259 A G 10: 79,977,985 V423A probably damaging Het
Tmem62 G T 2: 121,007,052 L483F probably damaging Het
Tnfrsf13b T C 11: 61,140,951 probably null Het
Txk C A 5: 72,736,377 C20F possibly damaging Het
Ube2w A C 1: 16,602,318 N46K probably benign Het
Unc79 A T 12: 103,047,663 H300L probably damaging Het
Unc79 T A 12: 103,083,596 H920Q probably benign Het
Vmn1r16 A G 6: 57,322,915 Y241H probably damaging Het
Vmn2r100 A T 17: 19,522,197 I278F possibly damaging Het
Zcchc6 A T 13: 59,789,260 I1191K probably damaging Het
Zfp260 T A 7: 30,105,459 H261Q probably damaging Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
Oblong UTSW 4 109091679 missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R7130:Osbpl9 UTSW 4 109083099 missense probably benign
R7356:Osbpl9 UTSW 4 109068480 nonsense probably null
R7615:Osbpl9 UTSW 4 109086339 missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 109133773 missense possibly damaging 0.86
R7772:Osbpl9 UTSW 4 109066187 missense probably damaging 0.99
R7788:Osbpl9 UTSW 4 109062494 missense probably benign 0.41
R8083:Osbpl9 UTSW 4 109086375 missense possibly damaging 0.74
R8143:Osbpl9 UTSW 4 109065709 missense probably benign 0.12
R8323:Osbpl9 UTSW 4 109107922 missense probably benign 0.01
R8331:Osbpl9 UTSW 4 109066181 missense probably damaging 1.00
R8406:Osbpl9 UTSW 4 109064573 missense possibly damaging 0.82
R8715:Osbpl9 UTSW 4 109102576 missense probably benign 0.21
Z1177:Osbpl9 UTSW 4 109107880 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAGGTTCCTGTGCACTCG -3'
(R):5'- CAAGTACTGCTAGTGTGCCCTG -3'

Sequencing Primer
(F):5'- ACTCGTTCATGCAGGGTCAG -3'
(R):5'- GTTCTTCCTCTTCAAGCAAAACAAGG -3'
Posted On2021-01-18