Incidental Mutation 'R8544:Fam234b'
ID659526
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Namefamily with sequence similarity 234, member B
Synonyms8430419L09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8544 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135197977-135244955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135233289 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 561 (Y561C)
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087729] [ENSMUST00000111909] [ENSMUST00000111910] [ENSMUST00000111911] [ENSMUST00000111915] [ENSMUST00000111916]
Predicted Effect probably benign
Transcript: ENSMUST00000087729
SMART Domains Protein: ENSMUSP00000085022
Gene: ENSMUSG00000030206

DomainStartEndE-ValueType
Pfam:GSG-1 11 125 2e-44 PFAM
Pfam:PMP22_Claudin 169 270 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111909
SMART Domains Protein: ENSMUSP00000107540
Gene: ENSMUSG00000030206

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 3.1e-44 PFAM
Pfam:PMP22_Claudin 12 226 4.5e-11 PFAM
Pfam:Claudin_2 20 226 8.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111910
SMART Domains Protein: ENSMUSP00000107541
Gene: ENSMUSG00000030206

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 5.2e-44 PFAM
Pfam:Claudin_2 20 267 1.5e-9 PFAM
Pfam:PMP22_Claudin 166 267 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111911
SMART Domains Protein: ENSMUSP00000107542
Gene: ENSMUSG00000030206

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 5.2e-44 PFAM
Pfam:Claudin_2 20 267 1.5e-9 PFAM
Pfam:PMP22_Claudin 166 267 8.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111915
AA Change: Y561C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207
AA Change: Y561C

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111916
AA Change: Y561C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207
AA Change: Y561C

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C A 15: 37,425,735 probably benign Het
A430105I19Rik C T 2: 118,757,221 R544K unknown Het
Abcb5 A T 12: 118,868,726 L1171H probably damaging Het
Ace A T 11: 105,971,290 probably null Het
Adsl G T 15: 80,948,533 probably benign Het
Cabin1 A G 10: 75,750,056 M215T probably benign Het
Cabp2 A T 19: 4,084,892 R77S probably damaging Het
Cast A T 13: 74,734,058 H40Q possibly damaging Het
Ccar1 A T 10: 62,750,579 Y946N unknown Het
Chst14 A G 2: 118,927,529 Y268C probably damaging Het
Dennd1a T C 2: 37,982,908 probably null Het
Dnah1 A G 14: 31,268,904 Y3153H probably damaging Het
Entpd8 T C 2: 25,083,844 V271A probably benign Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Fam126b T C 1: 58,529,822 T477A probably benign Het
Flg A G 3: 93,288,141 probably benign Het
Galnt5 T A 2: 58,017,148 M541K probably damaging Het
Gjd3 C A 11: 98,982,662 E119* probably null Het
Gm266 T C 12: 111,485,365 T136A possibly damaging Het
Gng11 G A 6: 4,008,045 C36Y possibly damaging Het
Gse1 G A 8: 120,553,652 V36I probably damaging Het
Invs A T 4: 48,397,598 H335L probably damaging Het
Kcnc2 A T 10: 112,456,196 I28F probably damaging Het
Klhl40 C T 9: 121,778,826 H351Y probably damaging Het
Kremen2 A G 17: 23,742,227 L382P probably benign Het
Lenep A T 3: 89,402,477 C55S possibly damaging Het
Lrp12 A T 15: 39,878,574 Y248* probably null Het
Man2c1 A G 9: 57,131,041 probably null Het
Map2k2 T C 10: 81,119,542 M32T possibly damaging Het
Mnt A G 11: 74,831,392 R22G probably damaging Het
Mroh1 G T 15: 76,443,358 E1127* probably null Het
Mtmr4 A G 11: 87,611,909 R930G possibly damaging Het
Nalcn A G 14: 123,371,523 V644A probably benign Het
Ngf G T 3: 102,520,675 V247F probably damaging Het
Ninj2 A G 6: 120,198,057 Y63C probably damaging Het
Olfr1226 T C 2: 89,193,968 E22G possibly damaging Het
Olfr577 A T 7: 102,973,731 I87N probably damaging Het
Phf12 A C 11: 78,027,409 I816L probably damaging Het
Pkhd1 C A 1: 20,522,975 G1638V probably damaging Het
Plce1 T A 19: 38,524,459 S67R probably benign Het
Plekhf1 A G 7: 38,221,344 F267L probably damaging Het
Poc1b A T 10: 99,124,908 K60* probably null Het
Ppic G A 18: 53,411,540 T66M probably damaging Het
Prep G T 10: 45,153,127 G541V probably damaging Het
Rasal3 C T 17: 32,392,119 V947I probably benign Het
Rbl1 T C 2: 157,193,204 R319G probably damaging Het
Rbm34 A G 8: 126,970,071 S94P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Sacm1l T C 9: 123,577,058 probably null Het
Scaf8 T C 17: 3,163,020 probably benign Het
Scrn1 T A 6: 54,522,856 T215S probably benign Het
Sfrp4 A G 13: 19,632,166 probably null Het
Slc37a3 T C 6: 39,344,363 I406V possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sptbn1 C A 11: 30,219,750 probably benign Het
St8sia5 T C 18: 77,254,418 Y275H probably damaging Het
Stab1 A T 14: 31,163,051 C137* probably null Het
Svep1 A G 4: 58,206,025 S118P probably benign Het
Tbx6 A G 7: 126,781,484 probably null Het
Tril C T 6: 53,819,310 S309N possibly damaging Het
Trmt13 A G 3: 116,592,445 probably null Het
Trpm1 T A 7: 64,224,608 probably null Het
Tyr T C 7: 87,492,792 T110A probably benign Het
Upf1 A C 8: 70,337,052 F711C probably damaging Het
Usp5 A T 6: 124,823,517 V267D probably damaging Het
Virma C A 4: 11,516,949 D714E probably benign Het
Vmn2r115 A C 17: 23,345,799 Q220P possibly damaging Het
Vmn2r40 T C 7: 8,908,192 I701V Het
Vwde T A 6: 13,187,653 M612L probably benign Het
Wwox A G 8: 114,488,906 T140A probably benign Het
Zbtb17 CCCCCACCTCCACAGACCCCA CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA 4: 141,466,828 probably benign Het
Zbtb9 T A 17: 26,974,474 C284* probably null Het
Zdhhc12 C A 2: 30,093,474 A39S probably benign Het
Zfp532 T A 18: 65,625,156 I720K possibly damaging Het
Zfp595 G A 13: 67,317,180 R340C probably damaging Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 splice site probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5313:Fam234b UTSW 6 135209187 missense possibly damaging 0.56
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7221:Fam234b UTSW 6 135228531 missense probably damaging 1.00
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7639:Fam234b UTSW 6 135225800 splice site probably null
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCATGTCCCTTTCAGACAAG -3'
(R):5'- TCTAGTTACCTGGTAGGGAGAATC -3'

Sequencing Primer
(F):5'- TTTCAGACAAGCACGGCTGATTC -3'
(R):5'- TTACCTGGTAGGGAGAATCAACAAAC -3'
Posted On2021-01-18