Incidental Mutation 'R8677:1190007I07Rik'
ID 661461
Institutional Source Beutler Lab
Gene Symbol 1190007I07Rik
Ensembl Gene ENSMUSG00000063320
Gene Name RIKEN cDNA 1190007I07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R8677 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 82619851-82623228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 82620216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 37 (T37K)
Ref Sequence ENSEMBL: ENSMUSP00000078593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079648] [ENSMUST00000176200] [ENSMUST00000183363] [ENSMUST00000183416] [ENSMUST00000185168]
AlphaFold Q8BTC1
Predicted Effect possibly damaging
Transcript: ENSMUST00000079648
AA Change: T37K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078593
Gene: ENSMUSG00000063320
AA Change: T37K

DomainStartEndE-ValueType
Pfam:DUF4516 1 46 1.5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176200
AA Change: T37K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134868
Gene: ENSMUSG00000063320
AA Change: T37K

DomainStartEndE-ValueType
Pfam:DUF4516 1 47 2.2e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183363
AA Change: T37K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139234
Gene: ENSMUSG00000063320
AA Change: T37K

DomainStartEndE-ValueType
Pfam:DUF4516 1 47 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183416
SMART Domains Protein: ENSMUSP00000139041
Gene: ENSMUSG00000063320

DomainStartEndE-ValueType
Pfam:DUF4516 1 40 1.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185168
AA Change: T37K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139244
Gene: ENSMUSG00000063320
AA Change: T37K

DomainStartEndE-ValueType
Pfam:DUF4516 1 47 2.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasal3 T C 17: 32,396,854 T337A probably benign Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in 1190007I07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:1190007I07Rik APN 10 82620116 utr 3 prime probably benign
R1985:1190007I07Rik UTSW 10 82620217 missense possibly damaging 0.71
R9127:1190007I07Rik UTSW 10 82622754 missense probably benign 0.05
R9235:1190007I07Rik UTSW 10 82622752 missense possibly damaging 0.71
R9393:1190007I07Rik UTSW 10 82622641 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTAACCTCTGAGCCATTGAGC -3'
(R):5'- CAGGACGATCTATTCAAGACAGCAAG -3'

Sequencing Primer
(F):5'- ATTGAGCCCCCTAAATTCGGTG -3'
(R):5'- CAAGAAATTCAGATCAATCAGGAGTC -3'
Posted On 2021-03-08