Incidental Mutation 'R8677:Rasal3'
ID661475
Institutional Source Beutler Lab
Gene Symbol Rasal3
Ensembl Gene ENSMUSG00000052142
Gene NameRAS protein activator like 3
SynonymsA430107D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8677 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32390659-32403583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32396854 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 337 (T337A)
Ref Sequence ENSEMBL: ENSMUSP00000123141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]
Predicted Effect probably benign
Transcript: ENSMUST00000063824
AA Change: T335A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: T335A

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 120 137 N/A INTRINSIC
PH 165 323 3.94e0 SMART
Blast:RasGAP 354 381 9e-8 BLAST
low complexity region 385 402 N/A INTRINSIC
RasGAP 433 755 2.03e-81 SMART
low complexity region 826 839 N/A INTRINSIC
coiled coil region 932 1013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135618
AA Change: T313A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: T313A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 9e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
RasGAP 411 733 2.03e-81 SMART
low complexity region 804 817 N/A INTRINSIC
coiled coil region 910 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136375
AA Change: T313A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: T313A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
PH 143 301 3.94e0 SMART
Blast:RasGAP 332 359 7e-8 BLAST
low complexity region 363 380 N/A INTRINSIC
Pfam:RasGAP 483 579 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137458
AA Change: T337A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: T337A

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 119 140 N/A INTRINSIC
PH 167 325 3.94e0 SMART
Blast:RasGAP 356 383 9e-8 BLAST
low complexity region 387 404 N/A INTRINSIC
RasGAP 435 757 2.03e-81 SMART
low complexity region 828 841 N/A INTRINSIC
coiled coil region 934 1015 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,595,471 D474G probably benign Het
1190007I07Rik G T 10: 82,620,216 T37K possibly damaging Het
2610507B11Rik C T 11: 78,284,156 R1706C probably damaging Het
Acd A C 8: 105,700,944 S25R probably damaging Het
Acly A T 11: 100,519,743 H136Q probably damaging Het
Adrm1 C T 2: 180,172,039 T2M probably benign Het
Ankrd12 A T 17: 66,024,214 L246M probably damaging Het
Cacnb3 T C 15: 98,642,050 L258P probably damaging Het
Ccdc129 A G 6: 55,872,594 H37R probably benign Het
Cd36 C T 5: 17,820,495 V76M probably damaging Het
Cep120 A G 18: 53,738,561 F80L possibly damaging Het
Clcn1 A T 6: 42,290,585 probably null Het
Col17a1 T C 19: 47,651,801 T1042A probably benign Het
Comp A T 8: 70,380,260 N623Y probably damaging Het
Ctnnal1 A G 4: 56,813,272 L653P probably benign Het
Cx3cl1 G T 8: 94,779,815 R149S probably benign Het
Dbndd2 T A 2: 164,488,602 N58K probably damaging Het
Dclk1 A G 3: 55,502,419 I595V probably damaging Het
Dhx15 T C 5: 52,184,544 D144G probably benign Het
Dlat T C 9: 50,658,707 E120G probably damaging Het
Fam171a1 T A 2: 3,220,315 Y273N probably damaging Het
Fndc3b A T 3: 27,457,027 V778D probably benign Het
Grn T C 11: 102,433,567 S129P possibly damaging Het
Grxcr1 T C 5: 68,110,414 F169L possibly damaging Het
Hcn2 A G 10: 79,724,785 I317V probably benign Het
Heca T C 10: 17,915,676 N211D probably benign Het
Htr1f T C 16: 64,926,051 T293A possibly damaging Het
Ifitm10 T A 7: 142,356,012 I116F probably benign Het
Ivl A T 3: 92,572,679 D26E probably benign Het
Kcnma1 T A 14: 23,386,350 E761V probably benign Het
Ltbp1 G T 17: 75,348,758 V923F probably benign Het
Mfsd4b2 A T 10: 39,923,809 F32L probably benign Het
Micu2 T C 14: 57,923,963 R301G possibly damaging Het
Miip C T 4: 147,863,046 C219Y probably damaging Het
Mn1 T A 5: 111,419,019 L285* probably null Het
Mthfd1l T A 10: 4,048,250 N664K possibly damaging Het
Mttp A T 3: 138,104,676 H659Q probably benign Het
Myadml2 G A 11: 120,647,989 P7S probably benign Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nlrp4c C T 7: 6,072,645 T645I probably damaging Het
Notch1 C T 2: 26,469,924 V1260I probably damaging Het
Numa1 T C 7: 102,000,941 L1293P probably damaging Het
Olfr403 A T 11: 74,195,589 I29F probably benign Het
Olfr684 A G 7: 105,157,568 L38P probably benign Het
Pcdh12 G T 18: 38,282,138 H645N probably benign Het
Pdcd1 A T 1: 94,041,227 L122H probably damaging Het
Pknox2 G A 9: 36,910,591 P246L probably damaging Het
Polr2a A T 11: 69,735,555 S1590T possibly damaging Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
Proser1 A G 3: 53,477,701 T335A probably benign Het
Ptprc A G 1: 138,083,597 I598T probably damaging Het
Rasgrp3 A T 17: 75,512,060 T415S probably benign Het
Rbm7 T A 9: 48,489,973 R152* probably null Het
Sf3b2 C T 19: 5,286,229 R513H probably damaging Het
Slc22a30 A G 19: 8,386,671 S214P probably benign Het
Spam1 A G 6: 24,796,985 T312A probably benign Het
Ssh2 A G 11: 77,455,193 T1335A possibly damaging Het
Tef T A 15: 81,814,968 L59Q probably damaging Het
Tmem131l A C 3: 83,928,702 V700G probably damaging Het
Twsg1 A G 17: 65,926,407 S183P probably damaging Het
Unc13c T C 9: 73,932,961 T203A probably benign Het
Vmn2r75 G T 7: 86,165,202 P361Q possibly damaging Het
Xirp2 A T 2: 67,516,634 N3073I probably damaging Het
Zfp114 A G 7: 24,180,645 N140D probably benign Het
Other mutations in Rasal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Rasal3 APN 17 32397405 missense possibly damaging 0.89
IGL02291:Rasal3 APN 17 32393737 unclassified probably benign
IGL02346:Rasal3 APN 17 32399349 missense probably damaging 1.00
IGL02422:Rasal3 APN 17 32398973 missense probably benign 0.11
Beaten UTSW 17 32391344 missense probably benign 0.05
bent UTSW 17 32396781 missense probably damaging 1.00
bowed UTSW 17 32396790 missense probably damaging 1.00
kinked UTSW 17 32396350 nonsense probably null
R0057:Rasal3 UTSW 17 32391383 missense probably benign 0.00
R0133:Rasal3 UTSW 17 32403383 start codon destroyed probably null 0.89
R0180:Rasal3 UTSW 17 32399405 missense probably benign
R0403:Rasal3 UTSW 17 32392790 splice site probably null
R0452:Rasal3 UTSW 17 32395817 splice site probably benign
R0600:Rasal3 UTSW 17 32393526 missense probably damaging 0.99
R0760:Rasal3 UTSW 17 32392172 missense probably benign 0.00
R1438:Rasal3 UTSW 17 32393535 splice site probably null
R1669:Rasal3 UTSW 17 32403098 missense possibly damaging 0.81
R1914:Rasal3 UTSW 17 32396350 nonsense probably null
R1928:Rasal3 UTSW 17 32397353 missense probably damaging 1.00
R2002:Rasal3 UTSW 17 32393611 missense probably damaging 1.00
R3053:Rasal3 UTSW 17 32403439 missense probably benign 0.03
R3770:Rasal3 UTSW 17 32392151 missense probably damaging 0.99
R3870:Rasal3 UTSW 17 32393548 missense possibly damaging 0.94
R4491:Rasal3 UTSW 17 32391385 missense probably damaging 0.99
R4783:Rasal3 UTSW 17 32396781 missense probably damaging 1.00
R4788:Rasal3 UTSW 17 32399338 missense probably benign 0.00
R4903:Rasal3 UTSW 17 32397383 missense probably damaging 1.00
R5185:Rasal3 UTSW 17 32396790 missense probably damaging 1.00
R5372:Rasal3 UTSW 17 32391344 missense probably benign 0.05
R5433:Rasal3 UTSW 17 32393601 missense probably benign 0.00
R5472:Rasal3 UTSW 17 32396669 missense probably damaging 1.00
R5920:Rasal3 UTSW 17 32395169 missense probably damaging 1.00
R6436:Rasal3 UTSW 17 32397504 missense probably damaging 1.00
R6837:Rasal3 UTSW 17 32403070 missense probably benign 0.17
R7047:Rasal3 UTSW 17 32396484 missense probably damaging 1.00
R7109:Rasal3 UTSW 17 32392709 missense probably damaging 1.00
R7179:Rasal3 UTSW 17 32392417 missense probably damaging 0.99
R7571:Rasal3 UTSW 17 32395861 missense possibly damaging 0.76
R7768:Rasal3 UTSW 17 32396793 missense probably damaging 0.96
R7874:Rasal3 UTSW 17 32396707 missense possibly damaging 0.75
R8155:Rasal3 UTSW 17 32397407 missense possibly damaging 0.93
R8265:Rasal3 UTSW 17 32395820 critical splice donor site probably null
R8544:Rasal3 UTSW 17 32392119 missense probably benign
R8695:Rasal3 UTSW 17 32392762 missense possibly damaging 0.93
RF004:Rasal3 UTSW 17 32391107 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32391219 missense probably damaging 1.00
X0027:Rasal3 UTSW 17 32392526 missense probably benign 0.00
X0065:Rasal3 UTSW 17 32403286 missense probably damaging 1.00
Z1177:Rasal3 UTSW 17 32399310 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAACTCGGCCAGCTCCTTATAG -3'
(R):5'- TAGATATTTGTGACCCCAGCTTC -3'

Sequencing Primer
(F):5'- TCCTTATAGCGCTCCGACGG -3'
(R):5'- AGCTTCTTCCCCAGGGG -3'
Posted On2021-03-08