Incidental Mutation 'R8766:Grhl3'
ID667874
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Namegrainyhead like transcription factor 3
SynonymsSom, ct, Get1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R8766 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location135541888-135573630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135573413 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 4 (E4D)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
Predicted Effect probably benign
Transcript: ENSMUST00000105855
AA Change: E4D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: E4D

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,774,040 N70I probably damaging Het
Actr10 T G 12: 70,954,656 probably null Het
Amz1 A G 5: 140,748,166 N166D probably benign Het
Asah2 A G 19: 32,057,880 F15S possibly damaging Het
Axin2 A G 11: 108,923,831 M182V probably damaging Het
Cacna1s T C 1: 136,075,143 L326P probably damaging Het
Ccdc169 T C 3: 55,150,824 probably null Het
Cct8 A T 16: 87,488,868 V234D probably damaging Het
Cdh19 T C 1: 110,890,114 R633G probably benign Het
Crat G A 2: 30,407,063 P293S probably benign Het
Crybg3 G A 16: 59,555,333 R139C probably benign Het
Ctbs A G 3: 146,459,833 N301S possibly damaging Het
Cyp4x1 T C 4: 115,110,065 H438R probably damaging Het
Dglucy C A 12: 100,871,447 H616Q probably benign Het
Dync1i1 T A 6: 5,767,142 L74Q possibly damaging Het
Epn1 T C 7: 5,092,861 S167P possibly damaging Het
Fbxw28 T C 9: 109,326,681 E341G probably benign Het
Gk2 T A 5: 97,456,251 M243L probably benign Het
Hsd17b13 T C 5: 103,977,143 K58R probably benign Het
Ighd5-7 G A 12: 113,464,528 Q9* probably null Het
Izumo1 G A 7: 45,627,072 S353N probably benign Het
Klhl31 T C 9: 77,650,163 S54P possibly damaging Het
Lonp2 T C 8: 86,636,570 M272T probably benign Het
Ltbp1 T A 17: 75,296,255 C682* probably null Het
Magi2 A G 5: 20,195,125 K52E probably benign Het
Nab2 C T 10: 127,666,548 probably benign Het
Ncapg2 T A 12: 116,426,736 V435D probably damaging Het
Nid2 A G 14: 19,752,272 D87G probably benign Het
Olfr461 T C 6: 40,544,551 M143V probably benign Het
Olfr518 A G 7: 108,881,246 M120T probably benign Het
Pamr1 T C 2: 102,550,193 M1T probably null Het
Pard3b T C 1: 62,159,478 C242R probably benign Het
Pcif1 T A 2: 164,885,426 V106E probably benign Het
Pitx2 T A 3: 129,218,574 F218I probably damaging Het
Ppip5k1 G T 2: 121,336,438 Y877* probably null Het
Prkch A G 12: 73,702,538 N354S probably benign Het
Psen2 T A 1: 180,245,636 D40V probably benign Het
Rfx7 T A 9: 72,616,739 S404T possibly damaging Het
Ryr2 T A 13: 11,668,969 T3070S probably damaging Het
Slc24a4 A G 12: 102,230,452 D263G probably benign Het
Tox T C 4: 6,823,047 E90G probably damaging Het
Unc13b C T 4: 43,174,722 S1850L unknown Het
Vmn1r5 T A 6: 56,986,115 D258E possibly damaging Het
Vmn2r84 C T 10: 130,386,372 V660M probably damaging Het
Zfp592 A T 7: 81,024,605 H439L probably benign Het
Zfp775 A T 6: 48,620,179 H329L probably damaging Het
Zswim5 T C 4: 116,958,807 L364P probably damaging Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
R0121:Grhl3 UTSW 4 135552549 missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135546250 missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135559104 nonsense probably null
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5180:Grhl3 UTSW 4 135559104 nonsense probably null
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135550329 missense probably benign
R8472:Grhl3 UTSW 4 135556865 missense probably benign 0.00
R8499:Grhl3 UTSW 4 135549238 critical splice donor site probably null
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGGAAACAGTCAGCTCTAG -3'
(R):5'- TGTGCTTCCAGCCAATCAGC -3'

Sequencing Primer
(F):5'- TAGAGAGCTGAACGTGCCTC -3'
(R):5'- GCCAATCAGCGCCACCG -3'
Posted On2021-03-08