Incidental Mutation 'R8695:Gml2'
ID668651
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Nameglycosylphosphatidylinositol anchored molecule like 2
SynonymsHemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8695 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location74819071-74834871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74824240 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000094130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000188180]
Predicted Effect probably benign
Transcript: ENSMUST00000096399
AA Change: N161S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600
AA Change: N161S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524J17Rik A G 8: 85,412,241 I73T probably benign Het
4930556J24Rik A G 11: 3,976,192 probably benign Het
Ace A G 11: 105,985,145 T1010A probably benign Het
Adam20 A T 8: 40,795,828 Y325F probably benign Het
Aff4 A C 11: 53,368,682 N7H probably damaging Het
Apob A T 12: 8,007,830 D2104V probably damaging Het
Asap3 T C 4: 136,238,411 S411P probably benign Het
Atxn1l C T 8: 109,731,830 G600D probably damaging Het
BC049730 A T 7: 24,713,778 H174L probably benign Het
Brd3 A T 2: 27,462,546 M124K probably benign Het
Bsx A G 9: 40,874,188 N4S probably damaging Het
Ccdc125 T C 13: 100,678,044 I44T probably benign Het
Ccdc141 G A 2: 77,049,619 T620I probably benign Het
Ccdc178 T A 18: 22,024,752 I550F probably benign Het
Ccdc77 G T 6: 120,342,001 T163N probably damaging Het
Cd55 A T 1: 130,452,536 I235K probably benign Het
Cdc123 A T 2: 5,821,363 M118K possibly damaging Het
Cep192 A T 18: 67,818,887 K378* probably null Het
Chd7 C T 4: 8,850,812 R1733C probably damaging Het
Crybg2 A T 4: 134,065,455 S134C possibly damaging Het
Cyp2d26 A G 15: 82,792,706 probably benign Het
D430041D05Rik A G 2: 104,254,954 probably null Het
Dyrk2 A T 10: 118,861,017 V112E probably benign Het
Eppk1 A G 15: 76,110,398 L761P probably benign Het
Evpl T C 11: 116,223,663 K1067R probably benign Het
Fancm C A 12: 65,125,173 D1862E probably damaging Het
Fhl2 A G 1: 43,128,411 V174A probably damaging Het
Gemin4 A T 11: 76,211,830 C702S probably damaging Het
Ggnbp2 T A 11: 84,869,941 D10V possibly damaging Het
Glul T C 1: 153,903,023 V26A probably benign Het
Gnao1 C A 8: 93,956,167 T327K probably damaging Het
Gpr179 A G 11: 97,336,298 V1677A possibly damaging Het
Greb1l A T 18: 10,544,450 H1348L probably benign Het
Grm8 T C 6: 28,126,031 H32R probably benign Het
Hk2 T A 6: 82,739,646 M302L probably benign Het
Hnrnpm C A 17: 33,658,910 M333I probably benign Het
Hsd3b1 A G 3: 98,852,907 I256T probably damaging Het
Irx5 G A 8: 92,360,699 G420R probably damaging Het
Krt87 A G 15: 101,434,020 V279A probably benign Het
Lamb2 G A 9: 108,486,166 S848N probably benign Het
Mc1r A T 8: 123,408,377 T290S probably benign Het
Olfr668 A T 7: 104,924,939 V275D probably benign Het
Olfr67 A T 7: 103,787,522 C252S possibly damaging Het
Olfr771 T A 10: 129,160,364 T207S probably damaging Het
Olfr963 A T 9: 39,669,080 T8S probably benign Het
Pex6 T C 17: 46,712,049 S184P probably damaging Het
Pglyrp3 A T 3: 92,026,455 S136C probably null Het
Pik3r1 A G 13: 101,757,554 S36P probably benign Het
Pomt2 G T 12: 87,110,016 T782K probably benign Het
Prdm9 T C 17: 15,544,757 H587R probably damaging Het
Prp2 A G 6: 132,599,969 Q73R unknown Het
Psmb4 T C 3: 94,886,124 N149D probably benign Het
Ptprj A T 2: 90,471,137 I217N possibly damaging Het
Rasal3 A G 17: 32,392,762 F797S possibly damaging Het
Rsrp1 T A 4: 134,925,299 M188K probably damaging Het
Senp8 A G 9: 59,737,216 I219T probably damaging Het
Serpinb10 A T 1: 107,540,900 N91I probably damaging Het
Skint4 C T 4: 112,118,067 R75C probably damaging Het
Slc25a48 C A 13: 56,465,012 A241E probably damaging Het
Smarcc1 G A 9: 110,173,904 R354H probably damaging Het
Spata21 G C 4: 141,111,444 probably null Het
Sptbn2 A G 19: 4,746,696 E1774G possibly damaging Het
Tep1 A T 14: 50,845,437 F1038Y possibly damaging Het
Thbs2 T A 17: 14,679,701 D638V probably benign Het
Tmem161a G T 8: 70,174,397 C33F probably damaging Het
Trim47 T C 11: 116,110,100 S41G probably benign Het
Trim56 T A 5: 137,114,575 H29L probably benign Het
Ugt2b35 T A 5: 87,008,205 H385Q probably damaging Het
Ugt2b37 T A 5: 87,242,384 H401L probably benign Het
Usp44 A C 10: 93,846,503 T272P probably damaging Het
Usp46 C T 5: 74,029,236 E156K probably benign Het
Vmn1r232 T C 17: 20,913,847 K164E probably benign Het
Zan T A 5: 137,386,955 N5072I unknown Het
Zfp318 T C 17: 46,412,650 S1860P probably benign Het
Zfp616 C T 11: 74,084,884 R660W probably benign Het
Zfp870 C T 17: 32,883,705 V217I possibly damaging Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74824221 nonsense probably null
R0031:Gml2 UTSW 15 74824276 missense probably benign 0.12
R0608:Gml2 UTSW 15 74821386 critical splice donor site probably null
R1087:Gml2 UTSW 15 74824097 missense possibly damaging 0.73
R1130:Gml2 UTSW 15 74821346 missense probably damaging 0.99
R1503:Gml2 UTSW 15 74821352 nonsense probably null
R4408:Gml2 UTSW 15 74824339 intron probably benign
R6802:Gml2 UTSW 15 74824246 missense probably damaging 1.00
R7351:Gml2 UTSW 15 74821376 missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74821368 nonsense probably null
R7910:Gml2 UTSW 15 74820530 critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74824155 missense probably damaging 1.00
X0066:Gml2 UTSW 15 74824050 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGAGAACACGTGCCTCCAG -3'
(R):5'- TGAGTACTCAATGCAGCAGG -3'

Sequencing Primer
(F):5'- CAGAACTCCCTAGGGTGCTTAAAG -3'
(R):5'- GGGCATTTTTGACAAACGATGC -3'
Posted On2021-04-30