Incidental Mutation 'R8714:Tyw1'
ID669762
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8714 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130269224 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 202 (R202Q)
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
Predicted Effect probably damaging
Transcript: ENSMUST00000040213
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044204
AA Change: R202Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100662
AA Change: R202Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: R202Q

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147619
AA Change: R179Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: R179Q

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,242,896 A137T probably benign Het
4930474N05Rik T A 14: 36,096,499 C151* probably null Het
Abca4 A G 3: 122,148,879 T1674A probably benign Het
Acat3 A T 17: 12,928,629 V167E probably benign Het
Alb T C 5: 90,461,015 probably null Het
Apol9a T C 15: 77,404,742 T142A probably benign Het
Asb14 C T 14: 26,901,075 P135S possibly damaging Het
Asb17 A G 3: 153,850,676 Y140C probably damaging Het
Atp4a T A 7: 30,720,588 I750N probably damaging Het
Bard1 T C 1: 71,030,827 Y664C probably damaging Het
Cacnb3 G A 15: 98,632,381 probably benign Het
Card11 T A 5: 140,913,392 D9V possibly damaging Het
Casp8 A T 1: 58,833,653 Q229H possibly damaging Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cep350 T C 1: 155,860,731 D2853G probably damaging Het
Cfap161 T C 7: 83,793,274 I110M probably benign Het
Chid1 T A 7: 141,513,765 K313* probably null Het
Col16a1 T A 4: 130,054,168 I227N unknown Het
D3Ertd751e G T 3: 41,746,563 E6* probably null Het
Ddx41 T C 13: 55,534,437 Q208R probably damaging Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dmrta1 A T 4: 89,691,445 Q214L probably benign Het
Eif2ak4 T C 2: 118,462,284 F1330L possibly damaging Het
Fbxw13 C T 9: 109,194,764 V71I probably benign Het
Gm8882 G A 6: 132,364,088 T7I unknown Het
H2-Q2 T C 17: 35,343,362 L195P possibly damaging Het
Hemgn C T 4: 46,395,904 G444D probably damaging Het
Lmtk2 A G 5: 144,176,058 T1199A probably damaging Het
Ly75 T C 2: 60,334,485 D783G probably damaging Het
Micall1 G A 15: 79,127,310 A627T probably benign Het
Morc2a C T 11: 3,675,877 T159I probably benign Het
Mthfr C A 4: 148,041,818 N115K probably damaging Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Mug1 C T 6: 121,882,722 P1227S probably benign Het
Ogfod3 T A 11: 121,196,782 D163V possibly damaging Het
Olfr644 T A 7: 104,068,276 I252F probably damaging Het
Pcnx2 C T 8: 125,773,807 V1515I probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr3 G T 11: 69,848,012 G167C probably benign Het
Plxna4 T A 6: 32,163,444 K1670* probably null Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rnf157 C A 11: 116,347,065 A577S probably benign Het
Rnf213 C T 11: 119,468,894 S4371L Het
S1pr1 A T 3: 115,711,821 S375T probably benign Het
Spen T C 4: 141,488,003 N506S unknown Het
Sulf1 T A 1: 12,807,917 Y210N probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tg A G 15: 66,684,042 N861S probably damaging Het
Ttc29 A G 8: 78,333,702 E417G possibly damaging Het
Ubxn7 T A 16: 32,367,411 probably benign Het
Vmn1r62 C A 7: 5,675,630 Y103* probably null Het
Zfp804b A T 5: 6,772,378 Y228* probably null Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8196:Tyw1 UTSW 5 130300021 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGGAAGCCTGCTTTAG -3'
(R):5'- ATCCCCAGGATGCAATTCG -3'

Sequencing Primer
(F):5'- CTGGAAGCCTGCTTTAGAGGAC -3'
(R):5'- CAGGATGCAATTCGCCTTG -3'
Posted On2021-04-30