Incidental Mutation 'R8787:Vps39'
ID670684
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R8787 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120342025 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 176 (S176P)
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect probably damaging
Transcript: ENSMUST00000028752
AA Change: S165P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: S165P

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102501
AA Change: S176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: S176P

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,275,053 H511Y possibly damaging Het
Acp5 G A 9: 22,127,193 R271* probably null Het
Adamts20 A T 15: 94,286,413 V1503E possibly damaging Het
Adra2b A T 2: 127,364,497 E311D probably benign Het
Aldh18a1 T C 19: 40,557,786 I556V possibly damaging Het
Alox12 C A 11: 70,253,320 A116S probably benign Het
Alox5 G T 6: 116,413,141 A552E probably damaging Het
Angpt1 G T 15: 42,512,384 L159I probably damaging Het
Atp2b4 CTT CTTTTT 1: 133,701,747 probably benign Het
Bub1b T A 2: 118,631,824 L726I probably damaging Het
Ccdc78 A T 17: 25,787,833 T165S probably benign Het
Ccdc88b T C 19: 6,847,423 D1323G probably damaging Het
Chek1 A T 9: 36,713,737 C349* probably null Het
Clec1a A T 6: 129,451,654 L21Q possibly damaging Het
Col1a1 T C 11: 94,942,808 V445A possibly damaging Het
Efcab7 A G 4: 99,900,594 T313A probably null Het
Fads1 T A 19: 10,192,961 Y288* probably null Het
Fgb T A 3: 83,046,662 T90S probably benign Het
Glg1 C A 8: 111,161,482 V1026L probably damaging Het
Gm11397 G A 13: 33,404,221 R263H probably benign Het
Gm30302 T C 13: 49,785,228 Y1002C probably damaging Het
Hadh T A 3: 131,234,176 Y313F probably damaging Het
Htr4 A G 18: 62,437,782 I303V possibly damaging Het
Kcnn3 A G 3: 89,645,450 D487G possibly damaging Het
L1td1 G A 4: 98,737,577 V604I probably benign Het
Lao1 A G 4: 118,968,368 T462A probably damaging Het
Lefty1 C A 1: 180,936,553 A86E probably damaging Het
Lmx1b T C 2: 33,639,510 Y79C Het
Lrp2 A G 2: 69,552,401 C47R probably damaging Het
Mrc2 A T 11: 105,347,639 N1204I probably benign Het
Ncf1 A C 5: 134,225,291 Y209* probably null Het
Olfr1080 G A 2: 86,553,953 T57M probably damaging Het
Olfr128 T A 17: 37,924,184 M206K probably benign Het
Olfr1368 A T 13: 21,142,283 M258K possibly damaging Het
Pcdhac1 T C 18: 37,091,889 V585A probably damaging Het
Pdcd11 T G 19: 47,108,580 L755R probably damaging Het
Pkhd1 A G 1: 20,288,237 V2705A probably damaging Het
Plch2 C A 4: 154,986,418 G1168V probably benign Het
Prpf39 T C 12: 65,042,781 Y98H possibly damaging Het
R3hdm2 T G 10: 127,457,652 S142A probably damaging Het
Rassf10 T A 7: 112,955,531 D446E probably benign Het
Rgs13 T C 1: 144,140,744 Y87C probably damaging Het
Smpd3 G A 8: 106,255,745 R576C probably damaging Het
Srsf11 A T 3: 158,012,400 D382E unknown Het
Stpg1 T A 4: 135,533,797 M306K probably benign Het
Svil C T 18: 5,059,332 Q696* probably null Het
Syna C T 5: 134,559,869 M75I probably benign Het
Synj2 T C 17: 5,986,239 F161S possibly damaging Het
Tek T C 4: 94,849,800 Y696H probably damaging Het
Tgfbr1 A T 4: 47,405,555 D386V possibly damaging Het
Tgm4 G T 9: 123,061,845 G503V probably damaging Het
Tnni3k T C 3: 154,940,054 E461G probably damaging Het
Tom1l1 A T 11: 90,671,105 H232Q probably benign Het
Ubqln5 T C 7: 104,129,122 N165S probably benign Het
Vmn1r24 G A 6: 57,955,973 L187F probably benign Het
Vmn2r82 C T 10: 79,378,060 T160I probably damaging Het
Vmn2r96 G T 17: 18,597,988 G801V probably damaging Het
Vsig10 C A 5: 117,334,916 H191Q probably benign Het
Wtap G A 17: 12,967,601 S353L possibly damaging Het
Zmym4 T G 4: 126,923,160 R248S probably benign Het
Zscan10 A G 17: 23,610,037 S518G probably benign Het
Zscan29 A T 2: 121,166,395 Y282N probably damaging Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
Jigsaw UTSW 2 120333416 missense probably damaging 0.98
matryoshka UTSW 2 120324695 missense probably damaging 1.00
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120345638 missense probably damaging 1.00
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5483:Vps39 UTSW 2 120323083 missense probably benign 0.08
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120321572 intron probably benign
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6004:Vps39 UTSW 2 120345650 missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
R6915:Vps39 UTSW 2 120321031 nonsense probably null
R7535:Vps39 UTSW 2 120324695 missense probably damaging 1.00
R7780:Vps39 UTSW 2 120325199 nonsense probably null
R7869:Vps39 UTSW 2 120339394 missense possibly damaging 0.89
R8061:Vps39 UTSW 2 120344211 missense probably benign 0.00
R8770:Vps39 UTSW 2 120323067 missense probably benign
R8933:Vps39 UTSW 2 120338585 missense probably benign 0.00
R8962:Vps39 UTSW 2 120344206 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTTGTGGAAATGCTAAGTGC -3'
(R):5'- AAGAATTGTGCTCAGGTATGGG -3'

Sequencing Primer
(F):5'- TAAGTGCACTCTCGCGC -3'
(R):5'- AGAATTGTGCTCAGGTATGGGTAGAG -3'
Posted On2021-04-30