Incidental Mutation 'R8762:Aplnr'
ID671827
Institutional Source Beutler Lab
Gene Symbol Aplnr
Ensembl Gene ENSMUSG00000044338
Gene Nameapelin receptor
Synonymsapelin receptor, APJ, Agtrl1, msr/apj
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8762 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85136225-85139923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85137171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 180 (Y180F)
Ref Sequence ENSEMBL: ENSMUSP00000053638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057019] [ENSMUST00000184728]
Predicted Effect probably benign
Transcript: ENSMUST00000057019
AA Change: Y180F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053638
Gene: ENSMUSG00000044338
AA Change: Y180F

DomainStartEndE-ValueType
Pfam:TAS2R 25 326 1.1e-8 PFAM
Pfam:7tm_1 43 307 4e-61 PFAM
Pfam:7TM_GPCR_Srv 46 324 3.5e-8 PFAM
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184728
SMART Domains Protein: ENSMUSP00000139142
Gene: ENSMUSG00000044338

DomainStartEndE-ValueType
SCOP:d1l9ha_ 1 47 7e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early lethality, decreased cardiac contractility, and decreased exercise endurance. Mice for another knock-out allele develop pulmonary venoocclusive disease with heart right ventricle hypertrophy and elevated pulmonary pressures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,566,602 N157S probably benign Het
Aarsd1 A G 11: 101,410,400 V272A probably benign Het
Acbd6 G A 1: 155,686,960 E236K probably damaging Het
Actr1b T C 1: 36,709,828 N9S probably benign Het
Adam17 A T 12: 21,351,594 D133E probably benign Het
Adam6b G A 12: 113,489,607 V15M probably damaging Het
Adam9 T A 8: 24,967,219 N631I probably damaging Het
Amy2a1 A T 3: 113,531,627 probably benign Het
Arhgef7 T C 8: 11,781,216 V105A probably benign Het
Bambi G A 18: 3,511,277 D33N probably damaging Het
Bicc1 G A 10: 70,943,386 T724I probably benign Het
Brd2 T A 17: 34,116,960 Q93L probably damaging Het
C130060K24Rik T C 6: 65,447,409 V182A probably benign Het
Cacnb2 A G 2: 14,967,948 D222G possibly damaging Het
Ccdc155 G T 7: 45,196,057 D152E probably damaging Het
Cdh1 G T 8: 106,659,704 D420Y probably damaging Het
Cep162 T C 9: 87,227,261 S430G probably benign Het
Cfap161 T A 7: 83,794,074 R27S possibly damaging Het
Chek1 C T 9: 36,718,340 A237T probably benign Het
Chrna3 T A 9: 55,015,711 K271M probably damaging Het
Coro7 A C 16: 4,634,339 V410G probably benign Het
Crmp1 C A 5: 37,284,096 N507K probably damaging Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Disc1 A G 8: 125,155,057 D577G probably damaging Het
Dnah6 A G 6: 73,179,828 Y649H possibly damaging Het
Flywch1 A G 17: 23,756,757 S504P probably damaging Het
Fpr1 A T 17: 17,877,589 V46D probably damaging Het
Fpr-rs7 C T 17: 20,113,527 V234M probably benign Het
Ighv5-16 T C 12: 113,838,668 N71D probably benign Het
Kdm3b A G 18: 34,804,104 M480V probably benign Het
L3mbtl3 T A 10: 26,276,223 D825V probably damaging Het
Lef1 T A 3: 131,194,717 M311K probably damaging Het
Magi1 T A 6: 93,815,808 R150* probably null Het
Magi3 C T 3: 104,050,853 V639I probably damaging Het
Mocos A T 18: 24,679,497 R483W probably damaging Het
Mrps11 G T 7: 78,788,739 V80F possibly damaging Het
Myh2 A T 11: 67,193,752 R1706W probably damaging Het
Neurod6 T A 6: 55,679,243 L136F probably damaging Het
Nfe2l1 A T 11: 96,820,480 Y308N probably damaging Het
Olfr1002 A T 2: 85,647,690 S210R probably damaging Het
Olfr388-ps1 G T 11: 73,724,481 T181N unknown Het
Oscar A G 7: 3,610,901 S227P probably benign Het
Phgdh A C 3: 98,339,708 I42R possibly damaging Het
Pla2g4a C T 1: 149,886,184 G174D probably benign Het
Plcd4 A G 1: 74,552,054 T203A possibly damaging Het
Plk3 ACACTCAC ACAC 4: 117,131,893 probably benign Het
Plppr4 A T 3: 117,325,833 V309D probably damaging Het
Pltp T C 2: 164,844,732 K324E possibly damaging Het
Pml C T 9: 58,247,065 R175H probably damaging Het
Psg20 C A 7: 18,674,632 V388F probably benign Het
Rabgef1 A G 5: 130,208,716 D209G possibly damaging Het
Rif1 A T 2: 52,111,730 N90I Het
Sec31a T C 5: 100,378,829 H57R Het
Sidt1 T C 16: 44,332,344 N62S probably benign Het
Slc18a2 T A 19: 59,272,923 M172K probably benign Het
Slc34a3 T C 2: 25,230,991 T362A probably benign Het
Smtn T G 11: 3,526,407 D158A probably benign Het
Spen C T 4: 141,472,950 V2789M probably damaging Het
Taf2 A T 15: 55,047,453 N608K probably benign Het
Tctn3 A G 19: 40,607,192 V383A unknown Het
Themis3 A T 17: 66,559,681 M188K probably benign Het
Trpv5 A G 6: 41,675,379 V124A probably benign Het
Tshr G A 12: 91,537,550 V421M probably damaging Het
Ttn T A 2: 76,709,082 D34520V probably benign Het
Ttn A C 2: 76,777,950 Y17876* probably null Het
Zrsr1 T C 11: 22,973,694 L156P probably benign Het
Other mutations in Aplnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aplnr APN 2 85137641 missense probably benign 0.00
IGL00985:Aplnr APN 2 85137663 missense probably benign 0.02
PIT4810001:Aplnr UTSW 2 85137284 missense probably damaging 1.00
R0009:Aplnr UTSW 2 85137276 splice site probably null
R0009:Aplnr UTSW 2 85137276 splice site probably null
R0201:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R1268:Aplnr UTSW 2 85137431 missense possibly damaging 0.80
R1386:Aplnr UTSW 2 85137461 missense possibly damaging 0.71
R1445:Aplnr UTSW 2 85137009 missense probably damaging 1.00
R1663:Aplnr UTSW 2 85136694 missense possibly damaging 0.53
R1967:Aplnr UTSW 2 85137606 missense probably benign
R4119:Aplnr UTSW 2 85136966 missense possibly damaging 0.96
R4672:Aplnr UTSW 2 85137180 missense probably damaging 1.00
R4916:Aplnr UTSW 2 85136917 missense probably damaging 1.00
R4968:Aplnr UTSW 2 85136945 missense probably damaging 1.00
R4990:Aplnr UTSW 2 85137377 missense probably damaging 0.96
R5067:Aplnr UTSW 2 85136784 missense probably damaging 1.00
R6235:Aplnr UTSW 2 85137626 missense probably benign
R6433:Aplnr UTSW 2 85136673 missense probably benign
R6828:Aplnr UTSW 2 85139759 utr 3 prime probably benign
R6898:Aplnr UTSW 2 85139811 utr 3 prime probably benign
R7547:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R8539:Aplnr UTSW 2 85136907 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGACCGATACCTGGCCATTG -3'
(R):5'- GGGCAAAGGTCACTACAAGC -3'

Sequencing Primer
(F):5'- CATTGTCAGGCCGGTGG -3'
(R):5'- GCACCACGATAATGCTGAGCAG -3'
Posted On2021-04-30