Incidental Mutation 'R1663:Aplnr'
ID186900
Institutional Source Beutler Lab
Gene Symbol Aplnr
Ensembl Gene ENSMUSG00000044338
Gene Nameapelin receptor
Synonymsapelin receptor, APJ, Agtrl1, msr/apj
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85136225-85139923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85136694 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000053638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057019] [ENSMUST00000184728]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057019
AA Change: D21G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053638
Gene: ENSMUSG00000044338
AA Change: D21G

DomainStartEndE-ValueType
Pfam:TAS2R 25 326 1.1e-8 PFAM
Pfam:7tm_1 43 307 4e-61 PFAM
Pfam:7TM_GPCR_Srv 46 324 3.5e-8 PFAM
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184728
SMART Domains Protein: ENSMUSP00000139142
Gene: ENSMUSG00000044338

DomainStartEndE-ValueType
SCOP:d1l9ha_ 1 47 7e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early lethality, decreased cardiac contractility, and decreased exercise endurance. Mice for another knock-out allele develop pulmonary venoocclusive disease with heart right ventricle hypertrophy and elevated pulmonary pressures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Aplnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aplnr APN 2 85137641 missense probably benign 0.00
IGL00985:Aplnr APN 2 85137663 missense probably benign 0.02
PIT4810001:Aplnr UTSW 2 85137284 missense probably damaging 1.00
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0201:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R1268:Aplnr UTSW 2 85137431 missense possibly damaging 0.80
R1386:Aplnr UTSW 2 85137461 missense possibly damaging 0.71
R1445:Aplnr UTSW 2 85137009 missense probably damaging 1.00
R1967:Aplnr UTSW 2 85137606 missense probably benign
R4119:Aplnr UTSW 2 85136966 missense possibly damaging 0.96
R4672:Aplnr UTSW 2 85137180 missense probably damaging 1.00
R4916:Aplnr UTSW 2 85136917 missense probably damaging 1.00
R4968:Aplnr UTSW 2 85136945 missense probably damaging 1.00
R4990:Aplnr UTSW 2 85137377 missense probably damaging 0.96
R5067:Aplnr UTSW 2 85136784 missense probably damaging 1.00
R6235:Aplnr UTSW 2 85137626 missense probably benign
R6433:Aplnr UTSW 2 85136673 missense probably benign
R6828:Aplnr UTSW 2 85139759 utr 3 prime probably benign
R6898:Aplnr UTSW 2 85139811 utr 3 prime probably benign
R7547:Aplnr UTSW 2 85137177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTGGAAGGACTCTAAGCAC -3'
(R):5'- TAAGTGGCCCACAGTGGCAAAG -3'

Sequencing Primer
(F):5'- GAAGGACTCTAAGCACCCTCAG -3'
(R):5'- GTCACCACAAAGGTCAAGTCAG -3'
Posted On2014-05-09