Incidental Mutation 'R8946:Olfr857'
ID 681308
Institutional Source Beutler Lab
Gene Symbol Olfr857
Ensembl Gene ENSMUSG00000094678
Gene Name olfactory receptor 857
Synonyms MOR146-8P, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8946 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19709433-19714930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19713589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 254 (T254I)
Ref Sequence ENSEMBL: ENSMUSP00000148617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]
AlphaFold A0A1L1SUS1
Predicted Effect probably damaging
Transcript: ENSMUST00000077023
AA Change: T254I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: T254I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212013
AA Change: T254I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,354,368 S393G probably damaging Het
Ankrd28 A G 14: 31,708,126 F862L probably damaging Het
Ankrd31 T C 13: 96,909,529 *1546Q probably null Het
Ankrd33b T C 15: 31,297,748 T288A probably benign Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Atp13a5 A G 16: 29,327,783 L231P probably damaging Het
C1qtnf12 T C 4: 155,966,425 F284L probably damaging Het
Caprin1 A T 2: 103,778,033 H250Q probably damaging Het
Cd2bp2 A C 7: 127,194,751 I122S probably damaging Het
Cd300lf T A 11: 115,133,912 probably benign Het
Ceacam14 A G 7: 17,814,074 I30V probably benign Het
Chchd1 T A 14: 20,703,317 *56R probably null Het
Ckap5 A G 2: 91,579,516 T948A probably benign Het
Clec12a A T 6: 129,363,986 N243I possibly damaging Het
Col11a2 A G 17: 34,051,783 M462V probably benign Het
Col6a5 C T 9: 105,945,634 E175K unknown Het
Csnka2ip T C 16: 64,480,304 probably benign Het
D130040H23Rik C A 8: 69,302,381 T146N possibly damaging Het
Dennd5b T C 6: 149,041,987 probably benign Het
E130309D02Rik C G 5: 143,315,040 E19Q probably benign Het
Fanci A G 7: 79,395,978 T23A probably benign Het
Fmnl1 T C 11: 103,180,915 Y83H probably damaging Het
Galnt13 C A 2: 54,880,063 T289N probably benign Het
Gcn1l1 A G 5: 115,595,345 D1074G probably benign Het
Gm10801 ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC ATTTTCAGTTTTC 2: 98,662,324 probably null Het
Gm5415 C T 1: 32,546,604 R75Q probably benign Het
Gnl1 T C 17: 35,983,587 I366T probably benign Het
Gtf2ird2 A T 5: 134,216,319 Y473F probably damaging Het
Ikzf1 T A 11: 11,769,485 D397E possibly damaging Het
Intu C T 3: 40,683,359 A425V possibly damaging Het
Jakmip1 G A 5: 37,185,740 probably null Het
Lif C A 11: 4,269,225 P168Q possibly damaging Het
Mrvi1 A T 7: 110,878,140 probably null Het
Myh11 A C 16: 14,230,716 S576A probably benign Het
Neb A G 2: 52,151,413 V6559A probably damaging Het
Nphs1 A G 7: 30,463,200 N368S probably damaging Het
Npsr1 G A 9: 24,313,229 V148I probably benign Het
Olfr1465 A T 19: 13,314,138 L49Q probably damaging Het
Olfr566 C A 7: 102,856,518 G255* probably null Het
Olfr599 T C 7: 103,338,366 F104S probably damaging Het
Olfr683 T A 7: 105,143,625 I223F probably damaging Het
Patz1 T C 11: 3,291,856 C415R probably damaging Het
Pcdha9 A T 18: 36,998,493 N205I possibly damaging Het
Pcdhga12 A T 18: 37,766,658 E181V probably benign Het
Pcnx T C 12: 81,971,384 Y1333H probably damaging Het
Phf7 A T 14: 31,248,149 probably benign Het
Pomc T G 12: 3,960,298 S180A probably benign Het
Ppp1r7 T A 1: 93,360,814 probably null Het
Prrc2c A T 1: 162,708,909 probably benign Het
Rsf1 GGC GGCCACGGCCGC 7: 97,579,906 probably benign Het
Senp1 T C 15: 98,042,901 K664E probably damaging Het
Skint7 A G 4: 111,982,001 N164S possibly damaging Het
Smg1 C A 7: 118,152,677 R2775M probably null Het
Snrnp27 C T 6: 86,676,244 V131M probably damaging Het
Spire1 C A 18: 67,496,616 R357L probably damaging Het
Sspo G A 6: 48,457,137 V959I probably damaging Het
St6galnac2 T C 11: 116,677,632 H335R probably damaging Het
Stard13 C T 5: 151,060,802 R623H probably damaging Het
Syde1 T A 10: 78,588,849 E383V probably damaging Het
Taf10 A G 7: 105,744,317 M1T probably null Het
Traf3ip3 A G 1: 193,187,107 C257R probably damaging Het
Trpm8 G A 1: 88,348,339 probably benign Het
Veph1 A G 3: 66,263,880 probably null Het
Vmn1r169 A T 7: 23,577,215 T11S possibly damaging Het
Wdhd1 A T 14: 47,245,295 S961T probably benign Het
Zfp773 T C 7: 7,132,470 T376A possibly damaging Het
Other mutations in Olfr857
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr857 APN 9 19713279 missense probably benign 0.00
IGL01919:Olfr857 APN 9 19713342 missense probably benign 0.00
IGL02157:Olfr857 APN 9 19713289 missense probably benign 0.07
IGL02550:Olfr857 APN 9 19713047 missense possibly damaging 0.92
IGL03329:Olfr857 APN 9 19713301 missense probably benign 0.16
IGL02799:Olfr857 UTSW 9 19713018 missense probably damaging 0.99
R0356:Olfr857 UTSW 9 19713447 missense probably damaging 1.00
R0927:Olfr857 UTSW 9 19713649 missense probably benign 0.39
R1161:Olfr857 UTSW 9 19713180 missense probably damaging 1.00
R1848:Olfr857 UTSW 9 19713090 missense probably benign 0.01
R5191:Olfr857 UTSW 9 19713334 missense probably damaging 0.98
R5216:Olfr857 UTSW 9 19713289 missense probably benign 0.07
R5259:Olfr857 UTSW 9 19712813 splice site probably null
R5342:Olfr857 UTSW 9 19713037 missense probably damaging 1.00
R5506:Olfr857 UTSW 9 19713274 missense possibly damaging 0.61
R5526:Olfr857 UTSW 9 19713698 nonsense probably null
R5594:Olfr857 UTSW 9 19713006 missense probably damaging 0.99
R5928:Olfr857 UTSW 9 19713753 missense probably benign 0.02
R6569:Olfr857 UTSW 9 19713342 missense probably benign 0.00
R6858:Olfr857 UTSW 9 19713469 missense probably damaging 0.98
R7077:Olfr857 UTSW 9 19713132 missense probably benign
R7378:Olfr857 UTSW 9 19712887 missense probably damaging 1.00
R7771:Olfr857 UTSW 9 19713471 missense probably benign
R8038:Olfr857 UTSW 9 19713680 missense possibly damaging 0.52
R8160:Olfr857 UTSW 9 19712789 intron probably benign
R8223:Olfr857 UTSW 9 19713409 missense probably benign
R8400:Olfr857 UTSW 9 19713093 missense probably benign 0.45
R8780:Olfr857 UTSW 9 19713357 missense possibly damaging 0.92
R9164:Olfr857 UTSW 9 19713658 missense probably benign 0.25
R9475:Olfr857 UTSW 9 19713643 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCCAGAACTTGTAAAACTTGCTTG -3'
(R):5'- GGGATCATGCAGGTAGTTAAATTATG -3'

Sequencing Primer
(F):5'- CTTGTAAAACTTGCTTGTTCTAACAC -3'
(R):5'- GTTATCTGACGGACAATTTTCCAGAG -3'
Posted On 2021-08-31