Incidental Mutation 'R9072:Nags'
ID 689619
Institutional Source Beutler Lab
Gene Symbol Nags
Ensembl Gene ENSMUSG00000048217
Gene Name N-acetylglutamate synthase
Synonyms 1700120E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102145513-102149477 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102147521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 351 (L351P)
Ref Sequence ENSEMBL: ENSMUSP00000050258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055409]
AlphaFold Q8R4H7
Predicted Effect probably damaging
Transcript: ENSMUST00000055409
AA Change: L351P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050258
Gene: ENSMUSG00000048217
AA Change: L351P

DomainStartEndE-ValueType
low complexity region 9 48 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:NAT 349 514 3.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-acetylglutamate synthase gene encodes a mitochondrial enzyme that catalyzes the formation of N-acetylglutamate (NAG) from glutamate and acetyl coenzyme-A. NAG is a cofactor of carbamyl phosphate synthetase I (CPSI), the first enzyme of the urea cycle in mammals. This gene may regulate ureagenesis by altering NAG availability and, thereby, CPSI activity. Deficiencies in N-acetylglutamate synthase have been associated with hyperammonemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: In the absence of N-carbamyl-L-glutamate and L-citrulline supplementation homozygous null mice develop severe hyperammonemia and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Hydin G A 8: 110,267,451 probably null Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Masp1 A C 16: 23,469,921 S710A probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr1466 A G 19: 13,341,874 T39A possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Svil T C 18: 5,097,500 I1574T probably benign Het
Tinag T A 9: 76,997,018 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Nags
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Nags APN 11 102149066 missense probably damaging 1.00
IGL02308:Nags APN 11 102149071 makesense probably null
IGL02551:Nags APN 11 102147941 missense probably damaging 1.00
IGL03114:Nags APN 11 102148988 missense probably damaging 1.00
R0254:Nags UTSW 11 102147945 missense probably damaging 1.00
R0395:Nags UTSW 11 102145704 missense unknown
R0573:Nags UTSW 11 102146979 missense probably damaging 0.97
R3085:Nags UTSW 11 102145984 missense probably damaging 1.00
R4687:Nags UTSW 11 102148196 missense probably damaging 0.97
R4852:Nags UTSW 11 102146621 nonsense probably null
R5093:Nags UTSW 11 102146569 missense probably damaging 1.00
R5516:Nags UTSW 11 102145947 nonsense probably null
R6374:Nags UTSW 11 102146511 missense possibly damaging 0.58
R6713:Nags UTSW 11 102146521 missense probably benign 0.27
R6741:Nags UTSW 11 102146892 missense possibly damaging 0.88
R7082:Nags UTSW 11 102147472 missense possibly damaging 0.90
R7903:Nags UTSW 11 102146677 missense possibly damaging 0.61
R8234:Nags UTSW 11 102148998 missense probably damaging 1.00
R9073:Nags UTSW 11 102147521 missense probably damaging 1.00
R9090:Nags UTSW 11 102146758 missense probably benign 0.25
R9271:Nags UTSW 11 102146758 missense probably benign 0.25
R9546:Nags UTSW 11 102148255 missense probably damaging 0.97
X0017:Nags UTSW 11 102145747 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCCTGGGACTTAGATCCTGAGC -3'
(R):5'- TTTAAACAGGGTGCCACAGC -3'

Sequencing Primer
(F):5'- TTAGATCCTGAGCAACGTGAACCTG -3'
(R):5'- AGAGTCAGGTCCACCGCTAG -3'
Posted On 2021-11-19