Mutagenetix > Incidental Mutation

Incidental Mutation 'R9072:Svil'

689639

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R9072 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5097500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1574 (I1574T)

Ref Sequence

ENSEMBL: ENSMUSP00000025079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

AlphaFold

Q8K4L3

Predicted Effect

probably benign
Transcript: ENSMUST00000025079
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: I1574T

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236
AA Change: I560T

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000126977
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: I1574T

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127297
AA Change: I1460T

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: I1460T

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131609
AA Change: I1574T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: I1574T

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140448
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: I1574T

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143254
AA Change: I1170T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: I1170T

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210707
AA Change: I1661T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,944,392	Y190*	probably null	Het
Agbl3	T	C	6: 34,799,452	C298R	probably damaging	Het
Ankrd26	T	A	6: 118,523,389	K1040N	probably damaging	Het
Ano3	T	A	2: 110,745,898	T93S	probably benign	Het
Apoc3	T	A	9: 46,233,234	I97F	probably benign	Het
Arid5a	A	G	1: 36,319,545	E401G	probably benign	Het
Atxn3	T	C	12: 101,937,471		probably null	Het
Brca1	C	T	11: 101,502,480		probably null	Het
C1ql3	T	A	2: 13,010,387	N154I	probably damaging	Het
Ccdc110	A	T	8: 45,942,838	M589L	probably benign	Het
Ccnb2	A	T	9: 70,410,813	F226I	possibly damaging	Het
Commd8	TTGTCATCT	TT	5: 72,160,984		probably null	Het
Dis3	T	C	14: 99,095,211	T262A	probably benign	Het
Eif4a2	G	A	16: 23,110,653	R234Q	probably benign	Het
Ephx2	G	A	14: 66,086,239	R481*	probably null	Het
Fbxo15	T	C	18: 84,965,520	I331T	possibly damaging	Het
Gfra2	A	G	14: 70,901,495	E121G	possibly damaging	Het
Git1	G	A	11: 77,499,075	A55T	probably benign	Het
Hfm1	T	C	5: 106,898,280	I553V	probably benign	Het
Hydin	G	A	8: 110,267,451		probably null	Het
Iqgap3	A	G	3: 88,109,466	N1085S		Het
Kbtbd12	T	C	6: 88,618,440	Y136C	probably damaging	Het
Kcng3	A	G	17: 83,630,994	Y209H	possibly damaging	Het
Kcnj2	A	T	11: 111,071,838	M19L	possibly damaging	Het
Lonrf2	A	T	1: 38,811,786	F232I	probably damaging	Het
Lrrc31	T	C	3: 30,699,710	D14G	probably benign	Het
Ly6l	G	A	15: 75,449,736	V62I	possibly damaging	Het
March8	T	C	6: 116,401,923	F273L	probably benign	Het
Masp1	A	C	16: 23,469,921	S710A	probably benign	Het
Mcm10	G	A	2: 5,008,603	R73C	possibly damaging	Het
Mcm5	G	A	8: 75,126,306	R682H	probably damaging	Het
Mink1	C	T	11: 70,608,381	T684I	possibly damaging	Het
Mocos	A	T	18: 24,664,032	Q83L	probably damaging	Het
Nags	T	C	11: 102,147,521	L351P	probably damaging	Het
Nalcn	G	A	14: 123,295,451	T1299I	possibly damaging	Het
Nlrp4b	A	G	7: 10,725,943	D824G	probably benign	Het
Nwd1	A	T	8: 72,695,418	M1031L	probably benign	Het
Olfr1164	T	A	2: 88,093,828	Q36L	probably benign	Het
Olfr1188	A	C	2: 88,560,314	I271L	probably benign	Het
Olfr1286	A	T	2: 111,420,360	I197N	possibly damaging	Het
Olfr1466	A	G	19: 13,341,874	T39A	possibly damaging	Het
Olfr657	C	T	7: 104,636,084	R137C	probably benign	Het
Olfr743	C	T	14: 50,533,754	T114I	probably benign	Het
Pan2	T	C	10: 128,315,181	M807T	probably damaging	Het
Parp8	A	T	13: 116,911,415	I222N	probably damaging	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Pou1f1	T	C	16: 65,531,947	L186P		Het
Ppargc1b	G	A	18: 61,310,659	R494W	probably damaging	Het
Prg4	G	T	1: 150,455,537	P462T	unknown	Het
Ptcd1	T	A	5: 145,154,715	I525L	probably benign	Het
Ptchd4	A	T	17: 42,502,759	Y517F	probably damaging	Het
Pum1	T	C	4: 130,752,861	F693S	probably damaging	Het
Ribc2	A	C	15: 85,137,962	Q186P	probably damaging	Het
Sesn2	C	A	4: 132,496,884		probably null	Het
Sgf29	G	A	7: 126,672,654	V284M	probably damaging	Het
Skap2	C	T	6: 51,879,770		probably null	Het
Smap1	T	A	1: 23,922,073	E28V	probably damaging	Het
Smc3	A	G	19: 53,628,769	N538D	probably benign	Het
Spen	T	C	4: 141,476,391	T1642A	unknown	Het
Spred3	G	A	7: 29,166,530	R115*	probably null	Het
Sugt1	T	A	14: 79,628,853	M304K	possibly damaging	Het
Sval1	T	C	6: 41,951,672	I6T	possibly damaging	Het
Tinag	T	A	9: 76,997,018		probably null	Het
Trak1	T	C	9: 121,460,488	L622P	probably damaging	Het
Ttn	C	T	2: 76,755,874	D21838N	probably damaging	Het
Ttn	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	2: 76,915,806		probably benign	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn1r73	C	T	7: 11,756,276	A7V	probably benign	Het
Yy1	G	T	12: 108,793,995	G195C	probably benign	Het
Zbtb17	T	A	4: 141,466,365	C607S	possibly damaging	Het
Zfp735	T	C	11: 73,712,234	V668A	probably benign	Het
Zfp819	C	A	7: 43,617,146	T351K	probably damaging	Het
Zfp820	C	A	17: 21,820,050	S99I	possibly damaging	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
R3779_Svil_985	UTSW	18	5090855	missense	probably damaging	0.97
R5433_Svil_176	UTSW	18	5059294	missense	probably damaging	0.99
R6062_Svil_873	UTSW	18	5106724	missense	probably damaging	1.00
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8752:Svil	UTSW	18	5060366	intron	probably benign
R8774:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8774-TAIL:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8780:Svil	UTSW	18	5063449	missense	probably benign	0.00
R8787:Svil	UTSW	18	5059332	nonsense	probably null
R8790:Svil	UTSW	18	5056098	missense	possibly damaging	0.82
R8974:Svil	UTSW	18	5099650	missense	probably damaging	1.00
R9029:Svil	UTSW	18	5056239	missense	probably benign
R9073:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9079:Svil	UTSW	18	5056308	missense	probably benign	0.31
R9181:Svil	UTSW	18	5090833	missense	possibly damaging	0.75
R9363:Svil	UTSW	18	5037155	missense	probably benign	0.02
R9377:Svil	UTSW	18	5057294	missense	probably benign	0.06
R9381:Svil	UTSW	18	5099013	missense	probably benign	0.06
R9389:Svil	UTSW	18	5090811	missense	possibly damaging	0.52
R9566:Svil	UTSW	18	5099661	missense	probably damaging	1.00
R9607:Svil	UTSW	18	5058126	missense	possibly damaging	0.92
R9716:Svil	UTSW	18	5062370	missense	probably damaging	1.00
R9801:Svil	UTSW	18	5049062	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACAGGGAGGTCCTTACATAAC -3'
(R):5'- TGCGGTCTCTGTATGGAAAG -3'

Sequencing Primer
(F):5'- ATAACTTGATTTAAAGCTTTGGGTGG -3'
(R):5'- CGGTCTCTGTATGGAAAGCAATG -3'

Posted On

2021-11-19