Incidental Mutation 'R9072:Svil'
ID 689639
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Name supervillin
Synonyms B430302E16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 4920540-5119299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5097500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1574 (I1574T)
Ref Sequence ENSEMBL: ENSMUSP00000025079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]
AlphaFold Q8K4L3
Predicted Effect probably benign
Transcript: ENSMUST00000025079
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: I1574T

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236
AA Change: I560T

DomainStartEndE-ValueType
low complexity region 168 178 N/A INTRINSIC
GEL 384 483 4.58e-22 SMART
GEL 508 625 4.03e-1 SMART
Blast:GEL 695 733 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126977
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: I1574T

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127297
AA Change: I1460T

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: I1460T

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131609
AA Change: I1574T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: I1574T

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140448
AA Change: I1574T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: I1574T

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143254
AA Change: I1170T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: I1170T

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210707
AA Change: I1661T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Hydin G A 8: 110,267,451 probably null Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Masp1 A C 16: 23,469,921 S710A probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nags T C 11: 102,147,521 L351P probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr1466 A G 19: 13,341,874 T39A possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Tinag T A 9: 76,997,018 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,915,806 probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5099045 missense probably benign 0.27
IGL00840:Svil APN 18 5063555 missense probably benign
IGL01329:Svil APN 18 5064501 missense probably benign
IGL01446:Svil APN 18 5062385 missense probably damaging 1.00
IGL02068:Svil APN 18 5092899 missense probably damaging 1.00
IGL02223:Svil APN 18 5105879 splice site probably benign
IGL02428:Svil APN 18 5118203 missense probably damaging 1.00
IGL02429:Svil APN 18 5118369 missense probably benign 0.00
IGL02479:Svil APN 18 5099476 missense probably damaging 1.00
IGL02560:Svil APN 18 5049379 missense probably benign 0.00
IGL02652:Svil APN 18 5114531 missense probably damaging 1.00
IGL03291:Svil APN 18 5056150 nonsense probably null
R3779_Svil_985 UTSW 18 5090855 missense probably damaging 0.97
R5433_Svil_176 UTSW 18 5059294 missense probably damaging 0.99
R6062_Svil_873 UTSW 18 5106724 missense probably damaging 1.00
BB002:Svil UTSW 18 5118357 missense probably benign 0.00
BB012:Svil UTSW 18 5118357 missense probably benign 0.00
IGL03055:Svil UTSW 18 5108615 missense probably damaging 1.00
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0266:Svil UTSW 18 5099063 splice site probably benign
R0281:Svil UTSW 18 5094582 missense probably damaging 1.00
R0442:Svil UTSW 18 5046870 missense probably damaging 1.00
R0549:Svil UTSW 18 5064566 missense possibly damaging 0.79
R0617:Svil UTSW 18 5117002 missense probably damaging 1.00
R0801:Svil UTSW 18 5099443 missense probably benign 0.00
R0894:Svil UTSW 18 5097494 missense probably damaging 1.00
R1053:Svil UTSW 18 5056690 missense probably benign 0.16
R1065:Svil UTSW 18 5063777 splice site probably benign
R1080:Svil UTSW 18 5058147 missense possibly damaging 0.79
R1199:Svil UTSW 18 5059217 splice site probably benign
R1472:Svil UTSW 18 5048950 missense probably benign 0.09
R1480:Svil UTSW 18 5057345 missense probably damaging 1.00
R1544:Svil UTSW 18 5046817 missense possibly damaging 0.93
R1626:Svil UTSW 18 5117099 critical splice donor site probably null
R1691:Svil UTSW 18 5056336 missense probably benign 0.06
R1812:Svil UTSW 18 5097545 missense probably damaging 1.00
R1826:Svil UTSW 18 5063383 missense probably benign 0.01
R1842:Svil UTSW 18 5062373 missense probably damaging 1.00
R1884:Svil UTSW 18 5094640 missense possibly damaging 0.94
R1945:Svil UTSW 18 5117059 missense probably damaging 1.00
R2184:Svil UTSW 18 5099534 missense probably damaging 1.00
R2184:Svil UTSW 18 5099615 missense probably damaging 1.00
R2232:Svil UTSW 18 5046640 start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5060613 splice site probably null
R3076:Svil UTSW 18 5116055 missense probably damaging 1.00
R3777:Svil UTSW 18 5090855 missense probably damaging 0.97
R3779:Svil UTSW 18 5090855 missense probably damaging 0.97
R3797:Svil UTSW 18 5060534 missense probably benign 0.29
R4077:Svil UTSW 18 5063522 missense probably benign 0.03
R4350:Svil UTSW 18 5118154 missense probably damaging 1.00
R4379:Svil UTSW 18 5046909 missense probably damaging 1.00
R4488:Svil UTSW 18 5049067 missense probably damaging 1.00
R4777:Svil UTSW 18 5088813 missense probably damaging 0.99
R4825:Svil UTSW 18 5114564 missense probably damaging 1.00
R4921:Svil UTSW 18 5108631 missense probably damaging 1.00
R4969:Svil UTSW 18 5095516 missense probably damaging 1.00
R4975:Svil UTSW 18 5054025 missense possibly damaging 0.61
R4990:Svil UTSW 18 5056810 missense probably benign 0.05
R4991:Svil UTSW 18 5056810 missense probably benign 0.05
R5061:Svil UTSW 18 5048954 missense probably benign 0.02
R5271:Svil UTSW 18 5062329 missense probably benign 0.45
R5362:Svil UTSW 18 5057345 missense probably damaging 1.00
R5433:Svil UTSW 18 5059294 missense probably damaging 0.99
R5677:Svil UTSW 18 5046823 nonsense probably null
R5850:Svil UTSW 18 5098900 splice site probably null
R5868:Svil UTSW 18 5056854 splice site probably null
R5871:Svil UTSW 18 5103669 splice site probably null
R5876:Svil UTSW 18 5082828 missense probably damaging 1.00
R6061:Svil UTSW 18 5106724 missense probably damaging 1.00
R6062:Svil UTSW 18 5106724 missense probably damaging 1.00
R6063:Svil UTSW 18 5106724 missense probably damaging 1.00
R6065:Svil UTSW 18 5106724 missense probably damaging 1.00
R6066:Svil UTSW 18 5106724 missense probably damaging 1.00
R6114:Svil UTSW 18 5108639 missense probably damaging 1.00
R6115:Svil UTSW 18 5108675 missense probably damaging 0.99
R6117:Svil UTSW 18 5116016 missense probably damaging 1.00
R6302:Svil UTSW 18 5057432 missense probably benign 0.13
R6418:Svil UTSW 18 5040171 missense probably benign 0.26
R6441:Svil UTSW 18 5049323 missense probably benign
R6446:Svil UTSW 18 5057323 missense probably benign 0.09
R6455:Svil UTSW 18 5056629 missense possibly damaging 0.89
R6545:Svil UTSW 18 5108621 missense probably benign 0.00
R6692:Svil UTSW 18 5082853 missense probably damaging 1.00
R6730:Svil UTSW 18 5049311 missense probably benign 0.17
R6763:Svil UTSW 18 5056437 missense probably damaging 0.99
R6870:Svil UTSW 18 5063231 missense possibly damaging 0.86
R6916:Svil UTSW 18 5114682 utr 3 prime probably benign
R7134:Svil UTSW 18 5116080 missense probably damaging 1.00
R7190:Svil UTSW 18 5092937 missense probably benign 0.01
R7213:Svil UTSW 18 5094574 missense probably damaging 0.99
R7249:Svil UTSW 18 5056270 missense probably benign 0.01
R7249:Svil UTSW 18 5062247 missense probably damaging 0.99
R7421:Svil UTSW 18 5056109 missense probably benign 0.18
R7571:Svil UTSW 18 5114636 missense probably damaging 1.00
R7574:Svil UTSW 18 5095188 missense probably benign 0.16
R7645:Svil UTSW 18 5099663 missense probably damaging 1.00
R7925:Svil UTSW 18 5118357 missense probably benign 0.00
R8113:Svil UTSW 18 5062385 missense probably damaging 1.00
R8263:Svil UTSW 18 5108679 missense probably damaging 1.00
R8485:Svil UTSW 18 5064566 missense probably benign 0.03
R8491:Svil UTSW 18 5106678 missense probably damaging 1.00
R8752:Svil UTSW 18 5060366 intron probably benign
R8774:Svil UTSW 18 5049068 missense probably damaging 1.00
R8774-TAIL:Svil UTSW 18 5049068 missense probably damaging 1.00
R8780:Svil UTSW 18 5063449 missense probably benign 0.00
R8787:Svil UTSW 18 5059332 nonsense probably null
R8790:Svil UTSW 18 5056098 missense possibly damaging 0.82
R8974:Svil UTSW 18 5099650 missense probably damaging 1.00
R9029:Svil UTSW 18 5056239 missense probably benign
R9073:Svil UTSW 18 5097500 missense probably benign 0.23
R9079:Svil UTSW 18 5056308 missense probably benign 0.31
R9181:Svil UTSW 18 5090833 missense possibly damaging 0.75
R9363:Svil UTSW 18 5037155 missense probably benign 0.02
R9377:Svil UTSW 18 5057294 missense probably benign 0.06
R9381:Svil UTSW 18 5099013 missense probably benign 0.06
R9389:Svil UTSW 18 5090811 missense possibly damaging 0.52
R9566:Svil UTSW 18 5099661 missense probably damaging 1.00
R9607:Svil UTSW 18 5058126 missense possibly damaging 0.92
R9716:Svil UTSW 18 5062370 missense probably damaging 1.00
R9801:Svil UTSW 18 5049062 missense probably damaging 1.00
X0065:Svil UTSW 18 5062317 missense probably damaging 1.00
Z1177:Svil UTSW 18 5062344 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACAGGGAGGTCCTTACATAAC -3'
(R):5'- TGCGGTCTCTGTATGGAAAG -3'

Sequencing Primer
(F):5'- ATAACTTGATTTAAAGCTTTGGGTGG -3'
(R):5'- CGGTCTCTGTATGGAAAGCAATG -3'
Posted On 2021-11-19