Incidental Mutation 'R9072:Hfm1'
ID 689590
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 068894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107046146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 553 (I553V)
Ref Sequence ENSEMBL: ENSMUSP00000108310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495] [ENSMUST00000148686] [ENSMUST00000200249]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: I553V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: I553V

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: I553V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: I553V

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,921,374 (GRCm39) Y190* probably null Het
Agbl3 T C 6: 34,776,387 (GRCm39) C298R probably damaging Het
Ankrd26 T A 6: 118,500,350 (GRCm39) K1040N probably damaging Het
Ano3 T A 2: 110,576,243 (GRCm39) T93S probably benign Het
Apoc3 T A 9: 46,144,532 (GRCm39) I97F probably benign Het
Arid5a A G 1: 36,358,626 (GRCm39) E401G probably benign Het
Atxn3 T C 12: 101,903,730 (GRCm39) probably null Het
Brca1 C T 11: 101,393,306 (GRCm39) probably null Het
C1ql3 T A 2: 13,015,198 (GRCm39) N154I probably damaging Het
Ccdc110 A T 8: 46,395,875 (GRCm39) M589L probably benign Het
Ccnb2 A T 9: 70,318,095 (GRCm39) F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,318,327 (GRCm39) probably null Het
Dis3 T C 14: 99,332,647 (GRCm39) T262A probably benign Het
Eif4a2 G A 16: 22,929,403 (GRCm39) R234Q probably benign Het
Ephx2 G A 14: 66,323,688 (GRCm39) R481* probably null Het
Fbxo15 T C 18: 84,983,645 (GRCm39) I331T possibly damaging Het
Gfra2 A G 14: 71,138,935 (GRCm39) E121G possibly damaging Het
Git1 G A 11: 77,389,901 (GRCm39) A55T probably benign Het
Hydin G A 8: 110,994,083 (GRCm39) probably null Het
Iqgap3 A G 3: 88,016,773 (GRCm39) N1085S Het
Kbtbd12 T C 6: 88,595,422 (GRCm39) Y136C probably damaging Het
Kcng3 A G 17: 83,938,423 (GRCm39) Y209H possibly damaging Het
Kcnj2 A T 11: 110,962,664 (GRCm39) M19L possibly damaging Het
Lonrf2 A T 1: 38,850,867 (GRCm39) F232I probably damaging Het
Lrrc31 T C 3: 30,753,859 (GRCm39) D14G probably benign Het
Ly6l G A 15: 75,321,585 (GRCm39) V62I possibly damaging Het
Marchf8 T C 6: 116,378,884 (GRCm39) F273L probably benign Het
Masp1 A C 16: 23,288,671 (GRCm39) S710A probably benign Het
Mcm10 G A 2: 5,013,414 (GRCm39) R73C possibly damaging Het
Mcm5 G A 8: 75,852,934 (GRCm39) R682H probably damaging Het
Mink1 C T 11: 70,499,207 (GRCm39) T684I possibly damaging Het
Mocos A T 18: 24,797,089 (GRCm39) Q83L probably damaging Het
Nags T C 11: 102,038,347 (GRCm39) L351P probably damaging Het
Nalcn G A 14: 123,532,863 (GRCm39) T1299I possibly damaging Het
Nlrp4b A G 7: 10,459,870 (GRCm39) D824G probably benign Het
Nwd1 A T 8: 73,422,046 (GRCm39) M1031L probably benign Het
Or11g27 C T 14: 50,771,211 (GRCm39) T114I probably benign Het
Or4c101 A C 2: 88,390,658 (GRCm39) I271L probably benign Het
Or4k40 A T 2: 111,250,705 (GRCm39) I197N possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Or5b112 A G 19: 13,319,238 (GRCm39) T39A possibly damaging Het
Or5d37 T A 2: 87,924,172 (GRCm39) Q36L probably benign Het
Pan2 T C 10: 128,151,050 (GRCm39) M807T probably damaging Het
Parp8 A T 13: 117,047,951 (GRCm39) I222N probably damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pou1f1 T C 16: 65,328,833 (GRCm39) L186P Het
Ppargc1b G A 18: 61,443,730 (GRCm39) R494W probably damaging Het
Prg4 G T 1: 150,331,288 (GRCm39) P462T unknown Het
Ptcd1 T A 5: 145,091,525 (GRCm39) I525L probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pum1 T C 4: 130,480,172 (GRCm39) F693S probably damaging Het
Ribc2 A C 15: 85,022,163 (GRCm39) Q186P probably damaging Het
Sesn2 C A 4: 132,224,195 (GRCm39) probably null Het
Sgf29 G A 7: 126,271,826 (GRCm39) V284M probably damaging Het
Skap2 C T 6: 51,856,750 (GRCm39) probably null Het
Smap1 T A 1: 23,961,154 (GRCm39) E28V probably damaging Het
Smc3 A G 19: 53,617,200 (GRCm39) N538D probably benign Het
Spen T C 4: 141,203,702 (GRCm39) T1642A unknown Het
Spred3 G A 7: 28,865,955 (GRCm39) R115* probably null Het
Sugt1 T A 14: 79,866,293 (GRCm39) M304K possibly damaging Het
Sval1 T C 6: 41,928,606 (GRCm39) I6T possibly damaging Het
Svil T C 18: 5,097,500 (GRCm39) I1574T probably benign Het
Tinag T A 9: 76,904,300 (GRCm39) probably null Het
Trak1 T C 9: 121,289,554 (GRCm39) L622P probably damaging Het
Ttn C T 2: 76,586,218 (GRCm39) D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,746,150 (GRCm39) probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r73 C T 7: 11,490,203 (GRCm39) A7V probably benign Het
Yy1 G T 12: 108,759,921 (GRCm39) G195C probably benign Het
Zbtb17 T A 4: 141,193,676 (GRCm39) C607S possibly damaging Het
Zfp735 T C 11: 73,603,060 (GRCm39) V668A probably benign Het
Zfp819 C A 7: 43,266,570 (GRCm39) T351K probably damaging Het
Zfp820 C A 17: 22,039,031 (GRCm39) S99I possibly damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGTTATTTACAACTATCCAGGCC -3'
(R):5'- ATCAGAAGCCCACACTTGTG -3'

Sequencing Primer
(F):5'- ATTTACAACTATCCAGGCCCCCTTC -3'
(R):5'- CACACTTGTGGTACGGATTCTTAG -3'
Posted On 2021-11-19