Incidental Mutation 'R9090:Zmym6'
ID 690882
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Name zinc finger, MYM-type 6
Synonyms Zfp258, D4Wsu24e, 9330177P20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9090 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127077383-127124372 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127124061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1212 (F1212I)
Ref Sequence ENSEMBL: ENSMUSP00000045366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094712] [ENSMUST00000094713] [ENSMUST00000106097]
AlphaFold Q8BS54
Predicted Effect probably damaging
Transcript: ENSMUST00000046751
AA Change: F1212I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: F1212I

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094712
SMART Domains Protein: ENSMUSP00000092302
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX 5 103 9e-9 PFAM
Pfam:DoxX_2 7 124 4.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094713
AA Change: F1120I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: F1120I

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106097
SMART Domains Protein: ENSMUSP00000101703
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX_2 27 111 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,114 S819T probably damaging Het
Abca13 A T 11: 9,291,698 D1187V probably damaging Het
AF366264 T C 8: 13,836,697 T465A possibly damaging Het
Ak9 C A 10: 41,424,627 T1611K unknown Het
Als2 G T 1: 59,203,030 T622K probably benign Het
Ankrd40 G A 11: 94,334,436 A98T probably benign Het
Ap1b1 T C 11: 5,023,174 L339P probably damaging Het
Appl1 A C 14: 26,947,127 H363Q probably benign Het
Atf6 T C 1: 170,794,676 N459D probably damaging Het
Ccdc129 G T 6: 55,967,066 R417L probably benign Het
Ccdc6 A T 10: 70,189,163 Q432L unknown Het
Ccl21a T A 4: 42,773,486 Q84L probably damaging Het
Cct4 A G 11: 23,001,389 I348V probably benign Het
Cd300ld2 A G 11: 115,013,724 Y106H probably damaging Het
Cdh19 C T 1: 110,949,217 E131K probably damaging Het
Cdon A G 9: 35,491,879 D1095G probably damaging Het
Cep85l T A 10: 53,281,574 R678* probably null Het
Chst3 T A 10: 60,185,643 S461C probably damaging Het
Clk1 A G 1: 58,420,153 I149T possibly damaging Het
Clvs2 T A 10: 33,513,305 D313V possibly damaging Het
Dap3 T C 3: 88,933,606 T75A probably benign Het
Dnaaf1 T A 8: 119,597,653 F631L probably benign Het
Dnah14 A T 1: 181,769,760 N3549I probably benign Het
Dnah17 A T 11: 118,041,044 Y3701N probably damaging Het
Dock6 A G 9: 21,841,500 V339A possibly damaging Het
Dpp6 T A 5: 27,598,834 C259* probably null Het
Dqx1 A G 6: 83,059,043 T119A probably benign Het
Dync1h1 G T 12: 110,616,876 R469L probably benign Het
Eno4 C T 19: 58,962,828 A424V probably benign Het
Fads1 T A 19: 10,185,798 D146E probably damaging Het
Fam171a1 C T 2: 3,223,506 T303M probably damaging Het
Fam189a2 A T 19: 23,994,857 I161N possibly damaging Het
Fam71a A G 1: 191,162,956 S497P probably damaging Het
Fbxw20 C T 9: 109,221,355 D401N probably benign Het
Fcho1 T A 8: 71,710,424 T654S possibly damaging Het
Flad1 C A 3: 89,408,551 E235* probably null Het
Flrt2 G T 12: 95,779,133 A82S probably benign Het
Gabrg3 A T 7: 57,179,638 S124T probably benign Het
Galt C T 4: 41,756,777 T139I probably benign Het
Gfod1 T C 13: 43,303,385 E38G possibly damaging Het
Gm10330 A G 12: 23,779,991 I63T possibly damaging Het
Gm15448 T A 7: 3,816,998 E640V unknown Het
Gm49359 A G 13: 62,455,053 V111A probably benign Het
Gpank1 C T 17: 35,121,758 probably benign Het
Hck T C 2: 153,131,265 L156P probably damaging Het
Hcn3 G T 3: 89,149,960 R444S probably damaging Het
Hephl1 T C 9: 15,076,940 N624S probably damaging Het
Hmcn1 A G 1: 150,756,558 I876T probably damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Itga9 T A 9: 118,671,791 D377E possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Klk11 C T 7: 43,776,530 L32F probably benign Het
Lta4h A G 10: 93,474,550 S427G probably benign Het
Lxn T A 3: 67,461,318 I122F probably damaging Het
Lyz1 A G 10: 117,288,587 V148A possibly damaging Het
Mael G T 1: 166,204,855 Q326K probably benign Het
Magi3 T C 3: 104,015,948 D1151G possibly damaging Het
Map3k9 C A 12: 81,722,487 G929V probably benign Het
Mcoln1 A G 8: 3,505,771 Y22C probably damaging Het
Mier3 G T 13: 111,691,336 M45I probably benign Het
Mrpl1 T C 5: 96,223,887 V91A probably damaging Het
Myo7a T C 7: 98,091,074 H571R probably benign Het
Myom1 T A 17: 71,067,330 W601R probably damaging Het
Myom3 C T 4: 135,778,168 T456I probably benign Het
Nags A T 11: 102,146,758 H225L probably benign Het
Ncaph C A 2: 127,116,634 K488N probably damaging Het
Nkain3 C T 4: 20,484,897 R60H probably damaging Het
Nlrp9a A T 7: 26,562,519 M698L probably benign Het
Nmur2 A C 11: 56,040,482 I134M probably benign Het
Nrp2 A C 1: 62,745,511 E273A probably benign Het
Nup85 A G 11: 115,577,961 D210G possibly damaging Het
Obscn A G 11: 59,115,817 F1173S probably damaging Het
Olfr206 A T 16: 59,344,782 C306* probably null Het
Otogl T A 10: 107,817,113 E1126V probably null Het
Pfkl T C 10: 77,997,592 I259V probably benign Het
Phkg1 A T 5: 129,865,022 Y291N probably benign Het
Piezo2 T G 18: 63,030,379 H2156P probably damaging Het
Piezo2 C A 18: 63,075,719 V1408L probably damaging Het
Plekhg3 A G 12: 76,575,920 T646A probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1r12a T C 10: 108,262,363 S838P probably damaging Het
Rarb A T 14: 16,435,235 Y270* probably null Het
Rbm15 T C 3: 107,331,996 E362G possibly damaging Het
Rcan1 A G 16: 92,465,853 F76L Het
Rdh19 T C 10: 127,860,273 L298P probably damaging Het
Rims1 T A 1: 22,428,522 H57L Het
Rlf T C 4: 121,147,554 T1520A probably benign Het
Rnase1 T A 14: 51,145,507 H130L possibly damaging Het
Samd8 T A 14: 21,792,501 M360K probably damaging Het
Samhd1 A G 2: 157,114,285 L329P probably damaging Het
Scube1 C T 15: 83,610,193 E878K probably damaging Het
Sema3b T C 9: 107,598,955 Y689C probably damaging Het
Sh3pxd2b A T 11: 32,423,361 N843Y possibly damaging Het
Slco1a6 C T 6: 142,089,849 C583Y probably damaging Het
Smg1 A C 7: 118,212,563 V88G unknown Het
Spata24 T A 18: 35,657,001 N146Y probably damaging Het
Tcf3 C A 10: 80,417,357 V258L probably benign Het
Tiam2 T C 17: 3,414,736 Y247H probably damaging Het
Ticrr T C 7: 79,660,856 F173L possibly damaging Het
Tpp2 A G 1: 43,954,651 E232G probably damaging Het
Trank1 T A 9: 111,345,479 V138E probably damaging Het
Ttll3 T C 6: 113,392,635 S47P probably benign Het
Utp4 C T 8: 106,906,225 T280M probably damaging Het
Vmn1r123 A T 7: 21,162,869 N229Y probably benign Het
Vmn1r85 A T 7: 13,085,015 Y67* probably null Het
Zbtb12 T A 17: 34,895,344 V35E possibly damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 127101949 nonsense probably null
IGL00486:Zmym6 APN 4 127124185 utr 5 prime probably benign
IGL01017:Zmym6 APN 4 127088359 missense probably benign 0.00
IGL01385:Zmym6 APN 4 127124106 missense probably benign 0.02
IGL01577:Zmym6 APN 4 127105430 missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127123726 missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127108644 missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127108706 missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127123756 missense probably damaging 0.98
IGL01985:Zmym6 APN 4 127100748 missense probably damaging 1.00
IGL02056:Zmym6 APN 4 127103414 missense probably damaging 1.00
IGL02477:Zmym6 APN 4 127078502 nonsense probably null
IGL02754:Zmym6 APN 4 127109971 splice site probably benign
IGL03344:Zmym6 APN 4 127120521 missense probably damaging 1.00
IGL03412:Zmym6 APN 4 127092938 missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127122808 missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127108694 missense probably benign 0.01
R0463:Zmym6 UTSW 4 127122772 missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127123369 missense probably benign 0.21
R0789:Zmym6 UTSW 4 127122822 missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 127103523 missense probably benign 0.00
R1311:Zmym6 UTSW 4 127123358 missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127123005 missense probably benign 0.00
R1429:Zmym6 UTSW 4 127123879 missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127123767 missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127122859 missense probably damaging 0.98
R1919:Zmym6 UTSW 4 127103414 missense probably damaging 1.00
R2058:Zmym6 UTSW 4 127088415 nonsense probably null
R3957:Zmym6 UTSW 4 127123296 missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127123555 missense possibly damaging 0.71
R4417:Zmym6 UTSW 4 127092988 missense probably damaging 1.00
R4801:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R4802:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R5052:Zmym6 UTSW 4 127123974 missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127123758 missense probably benign 0.33
R5217:Zmym6 UTSW 4 127105374 missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 127104407 missense probably damaging 1.00
R5841:Zmym6 UTSW 4 127100670 missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127108473 splice site probably null
R6478:Zmym6 UTSW 4 127123383 missense possibly damaging 0.86
R7014:Zmym6 UTSW 4 127123544 nonsense probably null
R7287:Zmym6 UTSW 4 127122982 missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127123501 missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 127104313 missense probably damaging 1.00
R7967:Zmym6 UTSW 4 127122660 missense probably benign 0.03
R8237:Zmym6 UTSW 4 127122751 missense probably damaging 0.99
R8306:Zmym6 UTSW 4 127122562 missense probably damaging 1.00
R8312:Zmym6 UTSW 4 127123834 missense probably damaging 1.00
R9216:Zmym6 UTSW 4 127108707 missense probably benign 0.00
R9271:Zmym6 UTSW 4 127124061 missense probably damaging 0.99
R9695:Zmym6 UTSW 4 127122547 missense probably benign
X0025:Zmym6 UTSW 4 127122350 missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 127104314 missense probably damaging 1.00
Z1177:Zmym6 UTSW 4 127123797 missense not run
Predicted Primers PCR Primer
(F):5'- CAATCTCACTGACTCCGAGGAAG -3'
(R):5'- CAGTTCCACAATTCTTAAATCCCTG -3'

Sequencing Primer
(F):5'- AGAGAAACTCGCCGTGTTATCTG -3'
(R):5'- TTCTTAAATCCCTGTACAACAAAGG -3'
Posted On 2021-12-30