Incidental Mutation 'R9097:Fut2'
ID 691416
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9097 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45648591-45666394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45650951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 132 (H132Q)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect probably benign
Transcript: ENSMUST00000069800
AA Change: H132Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: H132Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl G A 14: 34,071,703 V463I probably benign Het
Aox2 T A 1: 58,287,728 L162Q possibly damaging Het
Arhgap40 A T 2: 158,547,664 M586L probably benign Het
Arnt G T 3: 95,490,277 S535I probably benign Het
Bsx G T 9: 40,874,340 G55C probably damaging Het
Col9a1 A T 1: 24,185,126 I130F unknown Het
Cyp51 G T 5: 4,099,172 T235N possibly damaging Het
Depdc1a T A 3: 159,498,480 D55E probably benign Het
Dlc1 A T 8: 36,613,567 I10N probably benign Het
Dzank1 G T 2: 144,474,962 L767I possibly damaging Het
Eif3k A T 7: 28,972,235 *193K probably null Het
Eprs C A 1: 185,407,106 A896E probably benign Het
Evc2 T A 5: 37,393,161 F840I possibly damaging Het
Gbp11 T C 5: 105,326,481 *443W probably null Het
Gimd1 T A 3: 132,634,900 M59K probably benign Het
Glis2 A G 16: 4,611,776 T228A probably damaging Het
Gm21663 G C 5: 25,942,169 C46W probably benign Het
Gm8251 T C 1: 44,058,889 I1016M possibly damaging Het
Gpr162 A G 6: 124,859,607 I367T probably benign Het
Grik1 G A 16: 87,935,908 T692I Het
Igf2r G T 17: 12,691,213 A2043D probably damaging Het
Il12b C A 11: 44,410,280 L208M probably benign Het
Il12b T A 11: 44,410,281 L208Q probably damaging Het
Lrrk2 C T 15: 91,673,256 probably benign Het
Map3k9 T C 12: 81,773,081 D133G possibly damaging Het
Mrc2 A G 11: 105,340,572 D777G probably damaging Het
Mtrr A G 13: 68,575,322 L157P probably benign Het
Nol4l C A 2: 153,470,710 R226L probably damaging Het
Nsmaf CAAACTTTTAAACTT CAAACTT 4: 6,416,543 probably null Het
Olfr1014 T A 2: 85,777,325 V247E probably damaging Het
Olfr1303 T A 2: 111,813,851 K292* probably null Het
Olfr498 A T 7: 108,465,608 I95F probably damaging Het
Olfr562-ps1 A G 7: 102,782,268 H264R probably damaging Het
Olfr789 T A 10: 129,487,778 M256K possibly damaging Het
Olfr837 G A 9: 19,137,374 C127Y probably damaging Het
Pkn2 C T 3: 142,809,488 R695Q probably benign Het
Ppp1r9a A G 6: 4,906,012 D189G probably damaging Het
Prkca A G 11: 108,014,235 S226P probably benign Het
Ptpru T C 4: 131,772,532 N1267S probably damaging Het
Rrp12 A T 19: 41,890,138 D189E probably benign Het
Serpinb7 G A 1: 107,450,177 C200Y probably damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Stk32a A T 18: 43,313,432 M316L possibly damaging Het
Supt6 G T 11: 78,222,274 H948N probably benign Het
Sycp2l A T 13: 41,146,594 D428V possibly damaging Het
Tasp1 A T 2: 139,883,770 probably null Het
Telo2 T C 17: 25,105,092 T550A probably benign Het
Tmem131l A T 3: 83,942,815 N225K probably damaging Het
Tnc T C 4: 63,970,385 T1724A possibly damaging Het
Tyk2 C A 9: 21,108,776 E1029* probably null Het
Vav2 G A 2: 27,291,838 R330W probably damaging Het
Vmn1r16 A T 6: 57,323,265 I124N probably benign Het
Vmn1r181 A G 7: 23,985,019 N303S probably benign Het
Vmn1r50 G A 6: 90,108,040 V256I probably benign Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
R9087:Fut2 UTSW 7 45651069 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACATGCACATAGTCCCCTC -3'
(R):5'- CACGATCAATTCCATCGGCC -3'

Sequencing Primer
(F):5'- ACAAAGGTACTCGGCTGGCTC -3'
(R):5'- AATTCCATCGGCCGCCTG -3'
Posted On 2021-12-30