Incidental Mutation 'R4590:Fut2'
ID 342743
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4590 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 45648591-45666394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45650946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect possibly damaging
Transcript: ENSMUST00000069800
AA Change: N134S

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: N134S

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
R9087:Fut2 UTSW 7 45651069 missense probably damaging 1.00
R9097:Fut2 UTSW 7 45650951 missense probably benign 0.01
R9462:Fut2 UTSW 7 45651068 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACATGCACATAGTCCCCTC -3'
(R):5'- CCAGATGGGCGAATATGCTAC -3'

Sequencing Primer
(F):5'- ACAAAGGTACTCGGCTGGCTC -3'
(R):5'- ACATTGTTTGCACTGGCCAG -3'
Posted On 2015-09-24