Mutagenetix > Incidental Mutation

Incidental Mutation 'R9087:Fut2'

690678

Institutional Source

Beutler Lab

Gene Symbol

Fut2

Ensembl Gene

ENSMUSG00000055978

Gene Name

fucosyltransferase 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9087 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45648591-45666394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45651069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 93 (N93S)

Ref Sequence

ENSEMBL: ENSMUSP00000063719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]

AlphaFold

Q9JL27

Predicted Effect

probably damaging
Transcript: ENSMUST00000069800
AA Change: N93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: N93S

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_11	21	338	2.1e-139	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000210620
AA Change: N93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars	A	G	8: 111,041,537	D180G	probably damaging	Het
Abcb6	A	T	1: 75,173,567	I649K	probably damaging	Het
Ace	T	C	11: 105,981,919	F969S	probably damaging	Het
Ankrd26	A	G	6: 118,559,269		probably null	Het
Apobec1	A	T	6: 122,581,741	L9*	probably null	Het
Atp13a1	A	G	8: 69,803,807	D865G	probably damaging	Het
Barhl1	T	C	2: 28,915,219	Y154C	probably damaging	Het
Bbx	T	C	16: 50,274,635	D106G	probably damaging	Het
Cacna1a	G	A	8: 84,638,803	A2192T	probably benign	Het
Cacnb1	T	C	11: 98,003,007	N563S	possibly damaging	Het
Capn5	A	T	7: 98,126,324	I470N	probably damaging	Het
Cd300c	T	C	11: 114,959,765	T71A	probably damaging	Het
Celf4	T	A	18: 25,504,270	S223C	probably damaging	Het
Cftr	A	C	6: 18,214,181	I119L	possibly damaging	Het
Cmya5	T	C	13: 93,097,203	E459G	possibly damaging	Het
Cntn2	A	G	1: 132,525,370	Y395H	probably damaging	Het
Cntnap3	T	C	13: 64,751,718	D987G	probably damaging	Het
Col5a2	T	A	1: 45,442,658	D102V	unknown	Het
Cpeb2	T	C	5: 43,281,118	F812L		Het
Cpsf3	T	A	12: 21,308,994	L565Q	probably damaging	Het
Ctnnd1	A	C	2: 84,609,578	L796R	probably damaging	Het
Dach1	A	G	14: 98,168,831	L160P	probably benign	Het
Dennd1a	A	C	2: 38,021,354		probably null	Het
Dnah12	T	C	14: 26,824,546	I2431T	probably damaging	Het
Ep400	A	T	5: 110,667,564	Y2887*	probably null	Het
Erich1	T	C	8: 14,033,623	D149G	probably damaging	Het
Gba2	C	T	4: 43,568,304	A688T	probably benign	Het
Gcm2	C	G	13: 41,109,930	E9Q		Het
Gfod1	T	C	13: 43,200,362	E379G	probably damaging	Het
Gfod2	A	G	8: 105,728,219	F10L	probably damaging	Het
Gm4871	T	G	5: 145,032,278	H75P	possibly damaging	Het
Gtpbp3	T	A	8: 71,492,355	V418E	probably benign	Het
Hif1a	T	A	12: 73,942,325	I688K	probably benign	Het
Ifi44	G	T	3: 151,745,880	S196R	probably damaging	Het
Igfn1	T	C	1: 135,974,868		probably null	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kl	A	G	5: 150,988,492	K569E	probably benign	Het
Klkb1	G	A	8: 45,275,478	Q415*	probably null	Het
L1td1	A	G	4: 98,736,462	D298G	possibly damaging	Het
L2hgdh	C	T	12: 69,702,357	R252Q	probably benign	Het
Lipc	C	G	9: 70,802,108	K452N	probably benign	Het
Lrp10	C	A	14: 54,468,164	S270R	probably damaging	Het
Ly6e	T	G	15: 74,957,800	L14R	probably benign	Het
Mast3	T	C	8: 70,789,686	D90G	possibly damaging	Het
Mmp27	T	C	9: 7,579,857	F444S	probably damaging	Het
Mrgpra2b	A	T	7: 47,464,770	N71K	probably benign	Het
Nbea	C	A	3: 55,642,736		probably null	Het
Ndufb10	A	G	17: 24,724,185		probably null	Het
Ndufb9	C	T	15: 58,939,302	P146S	probably benign	Het
Nhsl1	T	C	10: 18,531,282	V1388A	probably damaging	Het
Nomo1	C	A	7: 46,083,324	D1170E	probably benign	Het
Nop2	G	T	6: 125,137,428	R254L	probably benign	Het
Nup160	A	T	2: 90,684,085	T126S	probably benign	Het
Olfr1049	A	G	2: 86,255,036	M219T	probably benign	Het
Olfr1107	A	G	2: 87,071,955	Y60H	probably damaging	Het
Olfr344	T	C	2: 36,569,333	L245P	probably damaging	Het
Olfr493	A	G	7: 108,346,751	S77P	probably damaging	Het
Olfr531	A	T	7: 140,400,634	C137*	probably null	Het
Olfr555	A	G	7: 102,659,757	K312R	probably benign	Het
Olfr675	C	T	7: 105,024,703	W92*	probably null	Het
Olfr917	A	G	9: 38,665,415	L143P	probably damaging	Het
Opa1	A	G	16: 29,618,235	D654G	probably damaging	Het
Osbp2	T	A	11: 3,717,976	D7V	probably damaging	Het
Osr2	A	T	15: 35,300,864	I189F	probably damaging	Het
Pdlim5	A	G	3: 142,352,833	V50A	possibly damaging	Het
Pik3r3	A	G	4: 116,291,734	N334S	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Ppfia4	A	G	1: 134,312,588	I889T	probably damaging	Het
Prpf38b	T	C	3: 108,904,341	K403E	unknown	Het
Rgs20	T	G	1: 4,923,967	E31A	possibly damaging	Het
Rpl11	A	T	4: 136,052,689	M12K	possibly damaging	Het
Rreb1	C	A	13: 37,931,668	T1001K	probably benign	Het
Ruvbl1	A	G	6: 88,497,373	K453E	probably benign	Het
Sdc4	A	T	2: 164,429,039	V100D	probably benign	Het
Simc1	C	A	13: 54,524,334	T165K	probably benign	Het
Slc2a3	A	G	6: 122,740,449	V16A	probably benign	Het
Smbd1	A	T	16: 32,806,760	S53T	possibly damaging	Het
Smndc1	A	T	19: 53,383,643	N113K	possibly damaging	Het
Tas2r139	T	G	6: 42,141,234	F100C	probably damaging	Het
Tubgcp5	A	G	7: 55,817,358	Y692C	probably damaging	Het
Ube2d2a	T	C	18: 35,800,144	I78T	probably benign	Het
Ugt2b37	C	T	5: 87,254,137	V212I	probably benign	Het
Wars2	A	G	3: 99,216,747	D308G	possibly damaging	Het
Yeats2	G	A	16: 20,211,750		probably null	Het
Zfp385a	G	T	15: 103,315,891	H219N	possibly damaging	Het
Zfp407	T	C	18: 84,209,857	T1876A	probably damaging	Het

Other mutations in Fut2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02814:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02831:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02982:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03071:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03090:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03126:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03146:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03151:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03179:Fut2	APN	7	45650649	missense	probably benign	0.02
IGL03212:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03213:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03234:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03271:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03372:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03381:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03385:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03392:Fut2	APN	7	45650769	missense	possibly damaging	0.94
PIT4515001:Fut2	UTSW	7	45650466	missense	probably damaging	1.00
R0553:Fut2	UTSW	7	45651274	missense	probably damaging	1.00
R1895:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R1946:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R2347:Fut2	UTSW	7	45650328	missense	probably damaging	0.99
R3155:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R3156:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R4590:Fut2	UTSW	7	45650946	missense	possibly damaging	0.64
R6311:Fut2	UTSW	7	45650380	missense	possibly damaging	0.46
R6810:Fut2	UTSW	7	45650505	missense	probably damaging	1.00
R6965:Fut2	UTSW	7	45650881	missense	probably damaging	1.00
R8135:Fut2	UTSW	7	45651142	missense	probably damaging	1.00
R9097:Fut2	UTSW	7	45650951	missense	probably benign	0.01
R9462:Fut2	UTSW	7	45651068	missense	probably damaging	1.00
X0066:Fut2	UTSW	7	45650374	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACTCCTTCAGGATCTCTGGGC -3'
(R):5'- CTCCAAACCCTGTCAGAGAAGG -3'

Sequencing Primer
(F):5'- GGTATCCCGTGAAACGCAC -3'
(R):5'- GAATTACAGGCGGTTCAAATGTCCTC -3'

Posted On

2021-12-30