Incidental Mutation 'R9087:Fut2'
ID 690678
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9087 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45648591-45666394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45651069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 93 (N93S)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: N93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: N93S

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210620
AA Change: N93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,041,537 D180G probably damaging Het
Abcb6 A T 1: 75,173,567 I649K probably damaging Het
Ace T C 11: 105,981,919 F969S probably damaging Het
Ankrd26 A G 6: 118,559,269 probably null Het
Apobec1 A T 6: 122,581,741 L9* probably null Het
Atp13a1 A G 8: 69,803,807 D865G probably damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
Bbx T C 16: 50,274,635 D106G probably damaging Het
Cacna1a G A 8: 84,638,803 A2192T probably benign Het
Cacnb1 T C 11: 98,003,007 N563S possibly damaging Het
Capn5 A T 7: 98,126,324 I470N probably damaging Het
Cd300c T C 11: 114,959,765 T71A probably damaging Het
Celf4 T A 18: 25,504,270 S223C probably damaging Het
Cftr A C 6: 18,214,181 I119L possibly damaging Het
Cmya5 T C 13: 93,097,203 E459G possibly damaging Het
Cntn2 A G 1: 132,525,370 Y395H probably damaging Het
Cntnap3 T C 13: 64,751,718 D987G probably damaging Het
Col5a2 T A 1: 45,442,658 D102V unknown Het
Cpeb2 T C 5: 43,281,118 F812L Het
Cpsf3 T A 12: 21,308,994 L565Q probably damaging Het
Ctnnd1 A C 2: 84,609,578 L796R probably damaging Het
Dach1 A G 14: 98,168,831 L160P probably benign Het
Dennd1a A C 2: 38,021,354 probably null Het
Dnah12 T C 14: 26,824,546 I2431T probably damaging Het
Ep400 A T 5: 110,667,564 Y2887* probably null Het
Erich1 T C 8: 14,033,623 D149G probably damaging Het
Gba2 C T 4: 43,568,304 A688T probably benign Het
Gcm2 C G 13: 41,109,930 E9Q Het
Gfod1 T C 13: 43,200,362 E379G probably damaging Het
Gfod2 A G 8: 105,728,219 F10L probably damaging Het
Gm4871 T G 5: 145,032,278 H75P possibly damaging Het
Gtpbp3 T A 8: 71,492,355 V418E probably benign Het
Hif1a T A 12: 73,942,325 I688K probably benign Het
Ifi44 G T 3: 151,745,880 S196R probably damaging Het
Igfn1 T C 1: 135,974,868 probably null Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl A G 5: 150,988,492 K569E probably benign Het
Klkb1 G A 8: 45,275,478 Q415* probably null Het
L1td1 A G 4: 98,736,462 D298G possibly damaging Het
L2hgdh C T 12: 69,702,357 R252Q probably benign Het
Lipc C G 9: 70,802,108 K452N probably benign Het
Lrp10 C A 14: 54,468,164 S270R probably damaging Het
Ly6e T G 15: 74,957,800 L14R probably benign Het
Mast3 T C 8: 70,789,686 D90G possibly damaging Het
Mmp27 T C 9: 7,579,857 F444S probably damaging Het
Mrgpra2b A T 7: 47,464,770 N71K probably benign Het
Nbea C A 3: 55,642,736 probably null Het
Ndufb10 A G 17: 24,724,185 probably null Het
Ndufb9 C T 15: 58,939,302 P146S probably benign Het
Nhsl1 T C 10: 18,531,282 V1388A probably damaging Het
Nomo1 C A 7: 46,083,324 D1170E probably benign Het
Nop2 G T 6: 125,137,428 R254L probably benign Het
Nup160 A T 2: 90,684,085 T126S probably benign Het
Olfr1049 A G 2: 86,255,036 M219T probably benign Het
Olfr1107 A G 2: 87,071,955 Y60H probably damaging Het
Olfr344 T C 2: 36,569,333 L245P probably damaging Het
Olfr493 A G 7: 108,346,751 S77P probably damaging Het
Olfr531 A T 7: 140,400,634 C137* probably null Het
Olfr555 A G 7: 102,659,757 K312R probably benign Het
Olfr675 C T 7: 105,024,703 W92* probably null Het
Olfr917 A G 9: 38,665,415 L143P probably damaging Het
Opa1 A G 16: 29,618,235 D654G probably damaging Het
Osbp2 T A 11: 3,717,976 D7V probably damaging Het
Osr2 A T 15: 35,300,864 I189F probably damaging Het
Pdlim5 A G 3: 142,352,833 V50A possibly damaging Het
Pik3r3 A G 4: 116,291,734 N334S probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppfia4 A G 1: 134,312,588 I889T probably damaging Het
Prpf38b T C 3: 108,904,341 K403E unknown Het
Rgs20 T G 1: 4,923,967 E31A possibly damaging Het
Rpl11 A T 4: 136,052,689 M12K possibly damaging Het
Rreb1 C A 13: 37,931,668 T1001K probably benign Het
Ruvbl1 A G 6: 88,497,373 K453E probably benign Het
Sdc4 A T 2: 164,429,039 V100D probably benign Het
Simc1 C A 13: 54,524,334 T165K probably benign Het
Slc2a3 A G 6: 122,740,449 V16A probably benign Het
Smbd1 A T 16: 32,806,760 S53T possibly damaging Het
Smndc1 A T 19: 53,383,643 N113K possibly damaging Het
Tas2r139 T G 6: 42,141,234 F100C probably damaging Het
Tubgcp5 A G 7: 55,817,358 Y692C probably damaging Het
Ube2d2a T C 18: 35,800,144 I78T probably benign Het
Ugt2b37 C T 5: 87,254,137 V212I probably benign Het
Wars2 A G 3: 99,216,747 D308G possibly damaging Het
Yeats2 G A 16: 20,211,750 probably null Het
Zfp385a G T 15: 103,315,891 H219N possibly damaging Het
Zfp407 T C 18: 84,209,857 T1876A probably damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
R9097:Fut2 UTSW 7 45650951 missense probably benign 0.01
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTCCTTCAGGATCTCTGGGC -3'
(R):5'- CTCCAAACCCTGTCAGAGAAGG -3'

Sequencing Primer
(F):5'- GGTATCCCGTGAAACGCAC -3'
(R):5'- GAATTACAGGCGGTTCAAATGTCCTC -3'
Posted On 2021-12-30