Mutagenetix > Incidental Mutation

Incidental Mutation 'R9144:Usp44'

694504

Institutional Source

Beutler Lab

Gene Symbol

Usp44

Ensembl Gene

ENSMUSG00000020020

Gene Name

ubiquitin specific peptidase 44

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9144 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93831555-93858088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93845783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 32 (T32A)

Ref Sequence

ENSEMBL: ENSMUSP00000092975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]

AlphaFold

Q8C2S0

Predicted Effect

probably benign
Transcript: ENSMUST00000095333
AA Change: T32A

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: T32A

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	26	88	5.4e-23	PFAM
Pfam:UCH	161	480	3.1e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216224
AA Change: T32A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	C	T	9: 44,281,411	V176M	possibly damaging	Het
Acp5	T	C	9: 22,129,946	T62A	probably benign	Het
Alad	A	T	4: 62,512,020	D88E	probably damaging	Het
Arap1	T	C	7: 101,398,395	I803T	probably damaging	Het
Bckdhb	C	A	9: 84,012,609	T312K	probably damaging	Het
Cfap206	A	G	4: 34,722,667	V138A	possibly damaging	Het
Cntnap5b	A	G	1: 100,050,787	Y176C	probably damaging	Het
Creld1	A	T	6: 113,484,507	T63S	probably damaging	Het
Dsc1	G	A	18: 20,085,582	T878I	possibly damaging	Het
Ehbp1	C	T	11: 22,068,463	R873H	probably damaging	Het
Eml2	T	C	7: 19,201,639	V466A	possibly damaging	Het
Ercc5	T	A	1: 44,174,351	Y836N	probably damaging	Het
Fgf20	T	C	8: 40,279,917	D160G		Het
Fgfr4	A	T	13: 55,168,024		probably null	Het
Fpr1	A	T	17: 17,877,364	V121D	probably damaging	Het
Gabbr1	A	G	17: 37,051,157	K218E	probably benign	Het
Galnt12	T	C	4: 47,113,822	L372P		Het
Gldc	A	G	19: 30,137,193	F439S		Het
Gm6465	A	G	5: 11,846,759	T32A	possibly damaging	Het
Has2	T	C	15: 56,682,192	R5G	probably benign	Het
Hexb	T	C	13: 97,181,091	Y366C	probably damaging	Het
Ier2	C	T	8: 84,662,637	V39I	probably benign	Het
Ifi214	A	G	1: 173,527,868	S125P	possibly damaging	Het
Kcnk15	A	G	2: 163,858,531	D230G	probably benign	Het
Kdm3b	A	T	18: 34,794,505	Y140F	probably benign	Het
Klk11	T	C	7: 43,777,631	V140A	probably damaging	Het
Klra5	C	T	6: 129,909,948	C39Y	probably benign	Het
Ltbp2	T	C	12: 84,809,652	I699M	probably damaging	Het
Mak	C	A	13: 41,048,118	E256*	probably null	Het
Mark3	C	A	12: 111,639,942	N496K	probably benign	Het
Mex3c	A	G	18: 73,590,326	T497A	probably benign	Het
Myt1	A	G	2: 181,826,012	I1160V	possibly damaging	Het
Notch1	T	C	2: 26,459,575	T2518A	probably benign	Het
Nsg1	A	G	5: 38,144,744	Y108H	probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Obscn	A	G	11: 59,069,277	S3255P	possibly damaging	Het
Olfr1143	A	G	2: 87,803,138	T246A	probably benign	Het
Plxna4	A	G	6: 32,185,561	V1339A	possibly damaging	Het
Ppp2r5e	C	T	12: 75,459,694	R433H	possibly damaging	Het
Pwwp2a	T	A	11: 43,705,894	C629S	probably benign	Het
Rasl10a	T	A	11: 5,058,473	S56R	probably benign	Het
Rhob	A	G	12: 8,499,124	V170A	probably damaging	Het
Rlf	A	T	4: 121,146,703	N1803K	probably benign	Het
Rmdn3	G	T	2: 119,139,366	Q405K	probably benign	Het
Rpap3	G	A	15: 97,691,303	T250M	possibly damaging	Het
Rraga	T	C	4: 86,576,559	I214T	probably damaging	Het
Rundc3a	A	T	11: 102,400,036	Q315L	probably benign	Het
Sh3bgr	T	A	16: 96,200,731	S10T	probably benign	Het
Skint6	A	T	4: 113,127,905	S421R	possibly damaging	Het
Spag16	G	C	1: 70,381,300	L482F	probably damaging	Het
Sppl2a	A	G	2: 126,927,823	S38P	probably benign	Het
Tex14	T	A	11: 87,522,597		probably null	Het
Tmem181a	G	A	17: 6,295,773	V181M	possibly damaging	Het
Traf3	T	A	12: 111,261,860	S502T	probably benign	Het
Trav9n-4	T	G	14: 53,294,779	V30G	probably damaging	Het
Trpm2	C	A	10: 77,929,288	V960L	probably benign	Het
Unc13b	T	A	4: 43,173,649	D1492E	unknown	Het
Vmn1r38	A	G	6: 66,776,628	M168T	probably benign	Het
Vmn1r9	A	G	6: 57,071,803	I288V	probably benign	Het
Zfhx3	A	G	8: 108,950,162	T2615A	possibly damaging	Het

Other mutations in Usp44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4378001:Usp44	UTSW	10	93845655	start gained	probably benign
R0497:Usp44	UTSW	10	93846806	missense	possibly damaging	0.77
R0789:Usp44	UTSW	10	93847220	intron	probably benign
R1521:Usp44	UTSW	10	93847186	nonsense	probably null
R4032:Usp44	UTSW	10	93847265	intron	probably benign
R4212:Usp44	UTSW	10	93846770	missense	possibly damaging	0.55
R4755:Usp44	UTSW	10	93846906	missense	probably damaging	1.00
R4764:Usp44	UTSW	10	93846071	missense	probably benign	0.17
R5095:Usp44	UTSW	10	93846845	missense	possibly damaging	0.70
R5775:Usp44	UTSW	10	93845978	missense	possibly damaging	0.80
R6029:Usp44	UTSW	10	93846632	missense	probably damaging	0.96
R6193:Usp44	UTSW	10	93847148	intron	probably benign
R6233:Usp44	UTSW	10	93850340	missense	probably damaging	1.00
R6338:Usp44	UTSW	10	93846513	missense	probably damaging	1.00
R6374:Usp44	UTSW	10	93856310	missense	probably benign	0.12
R6556:Usp44	UTSW	10	93846008	missense	probably benign	0.20
R6615:Usp44	UTSW	10	93846489	missense	possibly damaging	0.48
R7099:Usp44	UTSW	10	93850187	missense	possibly damaging	0.95
R7224:Usp44	UTSW	10	93845993	missense	probably benign	0.08
R7361:Usp44	UTSW	10	93846468	missense	probably benign	0.00
R7576:Usp44	UTSW	10	93846428	missense	probably damaging	0.99
R8014:Usp44	UTSW	10	93852709	critical splice acceptor site	probably null
R8695:Usp44	UTSW	10	93846503	missense	probably damaging	1.00
R8919:Usp44	UTSW	10	93857913	missense	probably benign	0.00
R8950:Usp44	UTSW	10	93846267	missense	possibly damaging	0.93
R9254:Usp44	UTSW	10	93852773	missense	possibly damaging	0.93
R9379:Usp44	UTSW	10	93852773	missense	possibly damaging	0.93
R9488:Usp44	UTSW	10	93846989	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GATAAACCAGGAGTCTTCGCTTAG -3'
(R):5'- CCGGCTGCGTTATCGTTTAG -3'

Sequencing Primer
(F):5'- AAGAACCTGATCTTGTTCGGC -3'
(R):5'- GCTGCGTTATCGTTTAGAACATAATC -3'

Posted On

2022-01-20