Incidental Mutation 'R4032:Usp44'
ID313541
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Nameubiquitin specific peptidase 44
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4032 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93831555-93858088 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 93847265 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
Predicted Effect unknown
Transcript: ENSMUST00000095333
AA Change: I479V
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: I479V

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216224
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap17 G T 7: 123,280,066 probably benign Het
Atp13a4 T A 16: 29,418,571 M846L probably damaging Het
Capn5 G T 7: 98,129,246 Q389K probably damaging Het
Cdkl3 T A 11: 52,011,291 I109N probably damaging Het
Cry2 T C 2: 92,413,827 I334V probably benign Het
Cs T C 10: 128,361,044 L436P probably damaging Het
D17H6S53E T C 17: 35,127,379 S89P probably benign Het
Dync1h1 C T 12: 110,618,049 Q629* probably null Het
Fam122a C T 19: 24,476,742 M205I probably benign Het
Hist1h4k T C 13: 21,750,418 I30V possibly damaging Het
Itpka C T 2: 119,742,601 P75S probably benign Het
Lyst C T 13: 13,616,665 H38Y probably damaging Het
Mansc4 T C 6: 147,075,180 K313E probably benign Het
Megf6 T A 4: 154,177,093 C58* probably null Het
Mtor T C 4: 148,536,752 V1869A probably benign Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Nek10 C A 14: 14,853,877 probably null Het
Nfkb1 T C 3: 135,594,349 S657G possibly damaging Het
Olfr447 A T 6: 42,911,625 Y34F probably benign Het
Olfr564 A G 7: 102,804,189 K237R probably benign Het
Olfr722 G T 14: 49,894,976 H275Q probably benign Het
Olfr734 T A 14: 50,320,310 D175V possibly damaging Het
Olfr976 T C 9: 39,956,333 T213A probably benign Het
Pde1b A G 15: 103,521,326 D82G probably damaging Het
Pdzrn4 C T 15: 92,769,533 T522M probably damaging Het
Ptpro C A 6: 137,461,742 N373K probably damaging Het
Ptprs T C 17: 56,413,386 Y1478C probably damaging Het
Sdc2 A T 15: 33,017,177 I46F probably damaging Het
Sergef C A 7: 46,443,302 E428* probably null Het
Stk36 A G 1: 74,626,048 S651G probably benign Het
Ubr5 A G 15: 38,024,837 V559A probably benign Het
Ugt8a C A 3: 125,874,158 D345Y probably damaging Het
Vps13a A T 19: 16,616,899 L3156Q probably damaging Het
Zfp655 A G 5: 145,244,048 T239A possibly damaging Het
Zfp72 T C 13: 74,372,330 T210A possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4212:Usp44 UTSW 10 93846770 missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACGGACAATTTCTTAGTCAGG -3'
(R):5'- GTATAGCAACTATGTCCTCCAGG -3'

Sequencing Primer
(F):5'- CAGGTATGGATGTCTTGCCAC -3'
(R):5'- TTTCAACCAGATATGGGGGCAC -3'
Posted On2015-04-30