Mutagenetix > Incidental Mutation

Incidental Mutation 'R5095:Usp44'

395832

Institutional Source

Beutler Lab

Gene Symbol

Usp44

Ensembl Gene

ENSMUSG00000020020

Gene Name

ubiquitin specific peptidase 44

Synonyms

MMRRC Submission

042684-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5095 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93831555-93858088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93846845 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 386 (I386F)

Ref Sequence

ENSEMBL: ENSMUSP00000149020 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]

AlphaFold

Q8C2S0

Predicted Effect

probably benign
Transcript: ENSMUST00000095333
AA Change: I339F

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020
AA Change: I339F

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	26	88	5.4e-23	PFAM
Pfam:UCH	161	480	3.1e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216224
AA Change: I386F

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Agbl1	G	A	7: 76,720,133	G660D	probably damaging	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Itga10	G	T	3: 96,648,164	V145L	probably benign	Het
Kcnh6	A	G	11: 106,017,254	D232G	possibly damaging	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Stxbp4	C	T	11: 90,548,975	V346I	probably benign	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Vmn2r15	T	C	5: 109,288,451		probably null	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Usp44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4378001:Usp44	UTSW	10	93845655	start gained	probably benign
R0497:Usp44	UTSW	10	93846806	missense	possibly damaging	0.77
R0789:Usp44	UTSW	10	93847220	intron	probably benign
R1521:Usp44	UTSW	10	93847186	nonsense	probably null
R4032:Usp44	UTSW	10	93847265	intron	probably benign
R4212:Usp44	UTSW	10	93846770	missense	possibly damaging	0.55
R4755:Usp44	UTSW	10	93846906	missense	probably damaging	1.00
R4764:Usp44	UTSW	10	93846071	missense	probably benign	0.17
R5775:Usp44	UTSW	10	93845978	missense	possibly damaging	0.80
R6029:Usp44	UTSW	10	93846632	missense	probably damaging	0.96
R6193:Usp44	UTSW	10	93847148	intron	probably benign
R6233:Usp44	UTSW	10	93850340	missense	probably damaging	1.00
R6338:Usp44	UTSW	10	93846513	missense	probably damaging	1.00
R6374:Usp44	UTSW	10	93856310	missense	probably benign	0.12
R6556:Usp44	UTSW	10	93846008	missense	probably benign	0.20
R6615:Usp44	UTSW	10	93846489	missense	possibly damaging	0.48
R7099:Usp44	UTSW	10	93850187	missense	possibly damaging	0.95
R7224:Usp44	UTSW	10	93845993	missense	probably benign	0.08
R7361:Usp44	UTSW	10	93846468	missense	probably benign	0.00
R7576:Usp44	UTSW	10	93846428	missense	probably damaging	0.99
R8014:Usp44	UTSW	10	93852709	critical splice acceptor site	probably null
R8695:Usp44	UTSW	10	93846503	missense	probably damaging	1.00
R8919:Usp44	UTSW	10	93857913	missense	probably benign	0.00
R8950:Usp44	UTSW	10	93846267	missense	possibly damaging	0.93
R9144:Usp44	UTSW	10	93845783	missense	probably benign	0.09
R9254:Usp44	UTSW	10	93852773	missense	possibly damaging	0.93
R9379:Usp44	UTSW	10	93852773	missense	possibly damaging	0.93
R9488:Usp44	UTSW	10	93846989	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- AGCGATAAGGCCCGATCCTATAAG -3'
(R):5'- AGGGCTGGTAACTTGGTTCC -3'

Sequencing Primer
(F):5'- GGCCCGATCCTATAAGCACTCAG -3'
(R):5'- CCGGTTGTCTCTAGTTCACG -3'

Posted On

2016-06-21