Incidental Mutation 'R0766:Otos'
List |< first << previous [record 19 of 37] next >> last >|
ID69489
Institutional Source Beutler Lab
Gene Symbol Otos
Ensembl Gene ENSMUSG00000044055
Gene Nameotospiralin
Synonyms
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92644218-92648841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92645351 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 14 (L14R)
Ref Sequence ENSEMBL: ENSMUSP00000061683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053144] [ENSMUST00000097642] [ENSMUST00000112999]
Predicted Effect probably damaging
Transcript: ENSMUST00000053144
AA Change: L14R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061683
Gene: ENSMUSG00000044055
AA Change: L14R

DomainStartEndE-ValueType
Pfam:OTOS 21 89 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097642
SMART Domains Protein: ENSMUSP00000095247
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
Pfam:MYEOV2 1 57 6.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112999
SMART Domains Protein: ENSMUSP00000108623
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
Pfam:MYEOV2 48 99 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129730
Predicted Effect probably benign
Transcript: ENSMUST00000148508
SMART Domains Protein: ENSMUSP00000123716
Gene: ENSMUSG00000073616

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159803
Meta Mutation Damage Score 0.6114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Otospiralin is synthesized by nonsensory cells (fibrocytes) of the inner ear, and downregulation of otospiralin in guinea pigs leads to deafness (Lavigne-Rebillard et al., 2003 [PubMed 12687421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display decreased endocochlear potentials and shrunken type II and IV cochlear fibrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Otos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03293:Otos APN 1 92644413 nonsense probably null
R1868:Otos UTSW 1 92644463 missense probably damaging 1.00
R3027:Otos UTSW 1 92644354 missense probably damaging 1.00
R4922:Otos UTSW 1 92644368 missense probably damaging 0.99
R4954:Otos UTSW 1 92644445 missense probably damaging 0.99
R5100:Otos UTSW 1 92644385 missense probably damaging 1.00
R5152:Otos UTSW 1 92644394 missense probably damaging 1.00
R7388:Otos UTSW 1 92644519 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGACTTGCACTGCCATAC -3'
(R):5'- TAGCATTCCTAAGGGTGGTCCACG -3'

Sequencing Primer
(F):5'- TGCACTGCCATACTTTAGGAGAC -3'
(R):5'- CTAGTGGGCATCGTCATCAT -3'
Posted On2013-09-30