Incidental Mutation 'R9150:Mgea5'
ID 695001
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Name meningioma expressed antigen 5 (hyaluronidase)
Synonyms 2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9150 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 45750261-45783520 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45782982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 50 (V50E)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
AlphaFold Q9EQQ9
Predicted Effect probably benign
Transcript: ENSMUST00000026243
AA Change: V50E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: V50E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b CTCCGGTGAGTGCCTCATCC CTCC 5: 137,555,092 probably null Het
Ampd1 A T 3: 103,081,043 I101F possibly damaging Het
Arhgap11a A G 2: 113,843,269 V92A possibly damaging Het
Arih1 C A 9: 59,436,786 L189F possibly damaging Het
B4galt3 A G 1: 171,276,326 R379G probably benign Het
BC080695 A G 4: 143,571,961 Y158C probably benign Het
C130026I21Rik T A 1: 85,113,638 Q33L probably damaging Het
Capn12 A G 7: 28,890,953 N642D probably benign Het
Cdc42ep3 T C 17: 79,334,870 H207R probably benign Het
Dcps A T 9: 35,124,642 L316H probably damaging Het
Dmgdh A G 13: 93,688,595 Y142C probably damaging Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml6 A T 11: 29,805,791 V821E probably benign Het
Fam181a A T 12: 103,315,880 N15Y probably damaging Het
Gm26657 G T 4: 56,740,835 E7* probably null Het
Gm8267 A T 14: 44,717,905 S220T probably benign Het
Gpld1 A T 13: 24,962,322 Y183F probably damaging Het
Gpr158 G A 2: 21,826,440 G784R probably benign Het
Grm2 A G 9: 106,647,458 L215P Het
Gtpbp1 A G 15: 79,707,964 D252G probably damaging Het
Heatr5b A G 17: 78,796,019 V1135A probably benign Het
Lrrc8e A C 8: 4,236,030 K752Q probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mapre2 A G 18: 23,858,151 T201A probably benign Het
Mcm9 A T 10: 53,626,014 N85K Het
Mdga1 T C 17: 29,838,446 T92A probably damaging Het
Mrvi1 T C 7: 110,898,998 T397A probably benign Het
Nemf A C 12: 69,341,046 D421E probably benign Het
Olfr1032 A T 2: 86,008,282 K169* probably null Het
Olfr1055 A T 2: 86,346,992 M258K probably damaging Het
Olfr177 G T 16: 58,872,642 C169* probably null Het
Olfr309 G C 7: 86,306,734 F126L probably damaging Het
Pcdhga5 A C 18: 37,694,880 N127T probably damaging Het
Phyhipl A T 10: 70,569,057 V107E probably damaging Het
Pkd1l1 G A 11: 8,836,256 R2383C Het
Ppp1r16a G A 15: 76,690,854 probably benign Het
Rnf41 T C 10: 128,436,530 V142A Het
Sgcd C T 11: 46,979,343 V264I probably damaging Het
Six2 A G 17: 85,685,335 S247P probably benign Het
Slc17a7 T G 7: 45,170,743 Y241D probably damaging Het
Slc30a5 T A 13: 100,803,407 K724* probably null Het
Slitrk1 T A 14: 108,911,669 I537F possibly damaging Het
Spen C T 4: 141,517,157 R189Q unknown Het
Srd5a3 T A 5: 76,149,768 L139Q probably damaging Het
Tgfbrap1 A T 1: 43,075,825 Y38* probably null Het
Tln2 A T 9: 67,221,496 M1437K probably damaging Het
Tmem87b T C 2: 128,845,481 I467T probably damaging Het
Tnfrsf21 T A 17: 43,087,800 I599N probably damaging Het
Trmt112 T A 19: 6,910,252 L23Q probably damaging Het
Tsc22d1 T A 14: 76,416,616 N178K probably damaging Het
Ttc23 A G 7: 67,726,102 Y476C probably damaging Het
Twf1 A T 15: 94,586,393 W83R probably damaging Het
Vmn2r14 T A 5: 109,219,917 H403L probably damaging Het
Wiz A T 17: 32,367,835 I167N probably benign Het
Zdhhc22 G A 12: 86,988,418 P87S probably benign Het
Zfp618 C T 4: 63,121,366 Q401* probably null Het
Zfp715 T A 7: 43,299,289 I416F possibly damaging Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5377:Mgea5 UTSW 19 45758022 nonsense probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
R7340:Mgea5 UTSW 19 45767456 nonsense probably null
R7437:Mgea5 UTSW 19 45778607 missense possibly damaging 0.76
R7490:Mgea5 UTSW 19 45767447 nonsense probably null
R7741:Mgea5 UTSW 19 45776062 missense probably damaging 1.00
R7823:Mgea5 UTSW 19 45776915 missense possibly damaging 0.51
R8017:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8019:Mgea5 UTSW 19 45773668 missense probably damaging 1.00
R8066:Mgea5 UTSW 19 45771852 missense probably damaging 0.99
R8075:Mgea5 UTSW 19 45761182 missense probably damaging 0.97
R8172:Mgea5 UTSW 19 45776900 missense probably damaging 0.99
R8558:Mgea5 UTSW 19 45758072 missense probably benign 0.00
R9050:Mgea5 UTSW 19 45767915 missense probably damaging 1.00
R9404:Mgea5 UTSW 19 45754657 frame shift probably null
R9562:Mgea5 UTSW 19 45754657 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTGTGAGCAATGACGGAC -3'
(R):5'- CAGGAGCTGCTTAGGGACTC -3'

Sequencing Primer
(F):5'- TGAGCAATGACGGACGCCTC -3'
(R):5'- CTGACAAAGGGCTCGAGC -3'
Posted On 2022-01-20