Incidental Mutation 'R9155:Hephl1'
ID 695311
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Name hephaestin-like 1
Synonyms LOC244698, zyklopen, Zp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 15051841-15112108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15089079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 292 (H292Q)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
AlphaFold Q3V1H3
Predicted Effect probably damaging
Transcript: ENSMUST00000159985
AA Change: H292Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: H292Q

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,543,945 E34G probably damaging Het
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Aldh1a3 A T 7: 66,409,119 L157* probably null Het
Asic2 T A 11: 80,894,046 T356S probably benign Het
Ate1 T C 7: 130,394,733 D459G probably damaging Het
Cacna1g T A 11: 94,459,597 Q474L Het
Carf C A 1: 60,150,683 T689K possibly damaging Het
Carmil2 A G 8: 105,686,290 D6G probably benign Het
Ccnd2 A C 6: 127,150,700 V25G probably damaging Het
Ccnk T A 12: 108,193,719 F153L probably damaging Het
Cdh23 C T 10: 60,413,706 G808E probably damaging Het
Clec11a C T 7: 44,304,893 R212Q probably damaging Het
Cog4 T C 8: 110,881,752 W749R probably damaging Het
Col6a3 T A 1: 90,810,579 T1073S probably benign Het
Col6a4 T A 9: 106,075,010 D563V probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crebbp A C 16: 4,096,482 H1292Q probably damaging Het
Csmd3 C A 15: 47,585,655 G2737W Het
Ddrgk1 T C 2: 130,658,307 Y223C probably damaging Het
Dennd1c T C 17: 57,066,796 Q589R probably benign Het
Dnah10 A G 5: 124,830,411 D4336G probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
E330034G19Rik A T 14: 24,296,870 Q140L possibly damaging Het
Ergic3 A G 2: 156,008,860 Y83C probably damaging Het
Fam171a2 A T 11: 102,438,671 S421T probably benign Het
Fam26f T C 10: 34,126,367 E240G probably damaging Het
Fndc3a T A 14: 72,683,722 H4L possibly damaging Het
Gid8 T A 2: 180,717,963 Y213* probably null Het
Gm9573 G A 17: 35,621,239 P685L unknown Het
Hexb T C 13: 97,177,906 Y443C probably damaging Het
Htr1f C T 16: 64,926,425 R168H probably benign Het
Hus1 A G 11: 9,006,056 I159T probably damaging Het
Inha A G 1: 75,509,489 T143A probably benign Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Itgae G T 11: 73,125,263 C766F possibly damaging Het
Kank4 T C 4: 98,778,326 E628G probably benign Het
Kctd19 T C 8: 105,393,939 H221R probably benign Het
Llgl1 A G 11: 60,707,108 E351G probably benign Het
Lrba A G 3: 86,295,201 Y253C probably damaging Het
Lrp2 T A 2: 69,461,369 R3489* probably null Het
Lrriq1 T C 10: 103,214,779 N704S probably benign Het
Mbtps1 T C 8: 119,508,954 N995S probably benign Het
Mga T C 2: 119,926,532 C1077R probably damaging Het
Ndufv1 A T 19: 4,009,912 C142S probably damaging Het
Nkx3-1 T C 14: 69,192,211 L226P probably damaging Het
Nsd1 C T 13: 55,213,440 R74W probably damaging Het
Olfr136 A T 17: 38,335,333 M59L probably damaging Het
Olfr1451 G A 19: 12,999,064 C26Y probably benign Het
Olfr361 A C 2: 37,085,004 M248R probably benign Het
Olfr412 A G 11: 74,364,965 T99A probably benign Het
Olfr855 A T 9: 19,585,083 D182V probably benign Het
Phc3 A G 3: 30,914,542 V812A probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppp4c A T 7: 126,787,247 C193S possibly damaging Het
Rbbp5 C A 1: 132,494,285 P308T probably damaging Het
Rhot1 A G 11: 80,257,554 T607A probably null Het
Secisbp2l G A 2: 125,775,703 P18L probably damaging Het
Slc27a4 G A 2: 29,811,282 G362S probably damaging Het
Slc4a8 T C 15: 100,774,690 Y36H probably damaging Het
Sox17 T C 1: 4,492,224 Y251C probably damaging Het
Taf4b T C 18: 14,813,239 V373A probably benign Het
Tecpr2 T A 12: 110,914,750 V107E probably damaging Het
Them7 A G 2: 105,378,779 Y148C probably damaging Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Ttn C T 2: 76,795,593 V15041I probably damaging Het
Ubr1 A G 2: 120,924,134 V751A possibly damaging Het
Vmn1r213 A T 13: 23,012,173 R309* probably null Het
Vmn2r10 A T 5: 108,996,346 D579E probably benign Het
Vmn2r118 T C 17: 55,610,207 Q435R probably null Het
Vmn2r50 A T 7: 10,047,644 H391Q probably damaging Het
Zbtb44 A T 9: 31,054,013 I240F probably benign Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
R7715:Hephl1 UTSW 9 15060785 missense probably benign 0.36
R8013:Hephl1 UTSW 9 15054609 missense possibly damaging 0.78
R8156:Hephl1 UTSW 9 15060914 missense possibly damaging 0.77
R8755:Hephl1 UTSW 9 15074267 missense probably benign
R8755:Hephl1 UTSW 9 15111984 missense probably damaging 1.00
R8777:Hephl1 UTSW 9 15060794 missense probably benign 0.24
R8777-TAIL:Hephl1 UTSW 9 15060794 missense probably benign 0.24
R9090:Hephl1 UTSW 9 15076940 missense probably damaging 1.00
R9271:Hephl1 UTSW 9 15076940 missense probably damaging 1.00
R9287:Hephl1 UTSW 9 15084479 missense probably benign 0.01
R9487:Hephl1 UTSW 9 15084534 missense possibly damaging 0.84
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Z1177:Hephl1 UTSW 9 15090054 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGAACCCATCTCGAGCC -3'
(R):5'- GCAGGAAAACATTATAGCAATGACC -3'

Sequencing Primer
(F):5'- CCATTGAGTTTACCTTGCAGG -3'
(R):5'- TGACCCACACACGGATTGTCTAG -3'
Posted On 2022-01-20