Incidental Mutation 'R9156:Tmem131'
ID 695348
Institutional Source Beutler Lab
Gene Symbol Tmem131
Ensembl Gene ENSMUSG00000026116
Gene Name transmembrane protein 131
Synonyms 2610524E03Rik, D1Bwg0491e, CC28, Neg, Rw1, YR-23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 36792191-36943666 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36841686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 168 (S168T)
Ref Sequence ENSEMBL: ENSMUSP00000027290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027290] [ENSMUST00000185964] [ENSMUST00000194563]
AlphaFold O70472
Predicted Effect possibly damaging
Transcript: ENSMUST00000027290
AA Change: S168T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027290
Gene: ENSMUSG00000026116
AA Change: S168T

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:TMEM131_like 106 189 1.7e-32 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185964
AA Change: S57T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000194563
AA Change: S168T

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142307
Gene: ENSMUSG00000026116
AA Change: S168T

DomainStartEndE-ValueType
low complexity region 5 44 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Pfam:DUF3651 170 243 1.9e-27 PFAM
Pfam:DUF3651 500 580 4.5e-16 PFAM
Pfam:DUF3651 631 706 5.2e-15 PFAM
transmembrane domain 1081 1103 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
low complexity region 1232 1258 N/A INTRINSIC
low complexity region 1283 1315 N/A INTRINSIC
low complexity region 1369 1382 N/A INTRINSIC
low complexity region 1384 1433 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1595 1610 N/A INTRINSIC
low complexity region 1613 1626 N/A INTRINSIC
low complexity region 1628 1646 N/A INTRINSIC
low complexity region 1675 1684 N/A INTRINSIC
low complexity region 1693 1701 N/A INTRINSIC
low complexity region 1738 1748 N/A INTRINSIC
low complexity region 1760 1779 N/A INTRINSIC
low complexity region 1799 1810 N/A INTRINSIC
Meta Mutation Damage Score 0.2141 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf123 A T 9: 108,063,028 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Rpp21 A T 17: 36,257,515 C23S probably benign Het
Scn11a T C 9: 119,759,923 M1306V possibly damaging Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Snap47 A T 11: 59,428,464 S283T probably damaging Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttll4 T C 1: 74,680,066 F359L probably benign Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubr1 A G 2: 120,873,122 probably null Het
Ubxn2b C T 4: 6,214,646 P227S probably damaging Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Tmem131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tmem131 APN 1 36811427 missense probably damaging 1.00
IGL00945:Tmem131 APN 1 36827005 splice site probably benign
IGL01107:Tmem131 APN 1 36829581 missense probably damaging 1.00
IGL01401:Tmem131 APN 1 36799387 missense probably damaging 1.00
IGL01533:Tmem131 APN 1 36818722 missense probably damaging 1.00
IGL01701:Tmem131 APN 1 36808237 missense probably benign 0.02
IGL01784:Tmem131 APN 1 36815483 missense probably damaging 1.00
IGL01890:Tmem131 APN 1 36823156 splice site probably benign
IGL01969:Tmem131 APN 1 36825460 missense possibly damaging 0.85
IGL02327:Tmem131 APN 1 36799022 missense probably damaging 1.00
IGL02707:Tmem131 APN 1 36825479 missense probably benign 0.03
IGL02743:Tmem131 APN 1 36793151 missense probably benign 0.00
IGL03111:Tmem131 APN 1 36828144 missense probably damaging 1.00
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0063:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R0238:Tmem131 UTSW 1 36828050 splice site probably benign
R0239:Tmem131 UTSW 1 36828050 splice site probably benign
R0499:Tmem131 UTSW 1 36841673 missense probably damaging 1.00
R0548:Tmem131 UTSW 1 36838038 missense probably damaging 1.00
R0845:Tmem131 UTSW 1 36816222 missense probably damaging 1.00
R0975:Tmem131 UTSW 1 36854885 missense probably damaging 1.00
R1018:Tmem131 UTSW 1 36794819 missense probably damaging 0.98
R1170:Tmem131 UTSW 1 36834898 nonsense probably null
R1443:Tmem131 UTSW 1 36825478 missense probably damaging 0.98
R1448:Tmem131 UTSW 1 36827358 missense probably benign 0.16
R1472:Tmem131 UTSW 1 36816241 missense possibly damaging 0.68
R1530:Tmem131 UTSW 1 36827009 critical splice donor site probably null
R1672:Tmem131 UTSW 1 36824759 missense probably damaging 1.00
R1872:Tmem131 UTSW 1 36807927 missense probably benign 0.05
R1914:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1915:Tmem131 UTSW 1 36796266 missense probably damaging 1.00
R1929:Tmem131 UTSW 1 36812271 missense possibly damaging 0.50
R1971:Tmem131 UTSW 1 36804599 nonsense probably null
R2146:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2148:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2149:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2150:Tmem131 UTSW 1 36812609 missense probably benign 0.13
R2386:Tmem131 UTSW 1 36829635 missense probably benign 0.00
R2879:Tmem131 UTSW 1 36841707 missense possibly damaging 0.76
R2903:Tmem131 UTSW 1 36825297 missense probably damaging 1.00
R3430:Tmem131 UTSW 1 36808821 splice site probably benign
R3821:Tmem131 UTSW 1 36808396 missense probably damaging 0.99
R3961:Tmem131 UTSW 1 36818950 missense probably damaging 1.00
R4153:Tmem131 UTSW 1 36808793 intron probably benign
R4154:Tmem131 UTSW 1 36808793 intron probably benign
R4502:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4503:Tmem131 UTSW 1 36825479 missense probably benign 0.03
R4795:Tmem131 UTSW 1 36841676 missense probably damaging 1.00
R5030:Tmem131 UTSW 1 36827174 missense possibly damaging 0.78
R5068:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5070:Tmem131 UTSW 1 36854905 missense probably damaging 1.00
R5386:Tmem131 UTSW 1 36872558 missense possibly damaging 0.47
R5507:Tmem131 UTSW 1 36889280 missense probably damaging 1.00
R5569:Tmem131 UTSW 1 36799338 missense probably benign 0.02
R5913:Tmem131 UTSW 1 36819128 missense probably benign 0.01
R6044:Tmem131 UTSW 1 36881341 nonsense probably null
R6125:Tmem131 UTSW 1 36808306 missense possibly damaging 0.95
R6259:Tmem131 UTSW 1 36819128 missense probably benign 0.09
R6392:Tmem131 UTSW 1 36881342 missense probably benign 0.10
R6704:Tmem131 UTSW 1 36796180 missense possibly damaging 0.77
R6828:Tmem131 UTSW 1 36804643 missense possibly damaging 0.46
R6964:Tmem131 UTSW 1 36796292 missense probably damaging 0.99
R7034:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7036:Tmem131 UTSW 1 36792973 missense possibly damaging 0.80
R7081:Tmem131 UTSW 1 36889295 missense possibly damaging 0.94
R7278:Tmem131 UTSW 1 36796301 missense probably damaging 0.99
R7282:Tmem131 UTSW 1 36841604 missense probably damaging 1.00
R7294:Tmem131 UTSW 1 36854847 missense possibly damaging 0.88
R7635:Tmem131 UTSW 1 36872548 missense probably damaging 1.00
R7916:Tmem131 UTSW 1 36823086 missense probably benign 0.00
R7948:Tmem131 UTSW 1 36794148 missense probably damaging 1.00
R8012:Tmem131 UTSW 1 36807964 missense probably damaging 1.00
R8244:Tmem131 UTSW 1 36808893 missense probably benign 0.08
R8461:Tmem131 UTSW 1 36794821 missense probably damaging 1.00
R8770:Tmem131 UTSW 1 36799105 splice site probably benign
R8902:Tmem131 UTSW 1 36808965 missense probably damaging 1.00
R8915:Tmem131 UTSW 1 36829577 missense probably damaging 1.00
R8984:Tmem131 UTSW 1 36828147 missense probably benign 0.05
R8994:Tmem131 UTSW 1 36815457 missense probably benign 0.29
R9105:Tmem131 UTSW 1 36815510 missense probably benign 0.44
R9328:Tmem131 UTSW 1 36819155 nonsense probably null
R9501:Tmem131 UTSW 1 36819184 missense possibly damaging 0.73
R9633:Tmem131 UTSW 1 36807988 missense probably damaging 0.99
Z1176:Tmem131 UTSW 1 36796257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCTAAACCTAATGTCCTG -3'
(R):5'- GTACAACAGTGTGGCTAACTTG -3'

Sequencing Primer
(F):5'- GCCCTAAACCTAATGTCCTGTATTTC -3'
(R):5'- ACAGTGTGGCTAACTTGAAGGTTAG -3'
Posted On 2022-01-20