Incidental Mutation 'R9165:Ak9'
ID 696002
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Name adenylate kinase 9
Synonyms LOC215946, Akd1, Gm7127, Akd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9165 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 41303980-41434534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41433239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1879 (K1879R)
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
AlphaFold G3UYQ4
Predicted Effect unknown
Transcript: ENSMUST00000173494
AA Change: K1879R
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: K1879R

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,615,244 I248V probably benign Het
1700122O11Rik T C 17: 48,037,548 I27V probably benign Het
A2ml1 T A 6: 128,560,669 H693L probably benign Het
Acacb A G 5: 114,216,683 E1206G probably benign Het
Acoxl A G 2: 127,884,512 T269A probably benign Het
Amot A T X: 145,461,749 L435H Het
Bnc2 A T 4: 84,411,494 L95Q Het
Bpifa2 G T 2: 154,009,821 W59L probably benign Het
Cd209a T A 8: 3,745,602 Q156H probably damaging Het
Cep104 T A 4: 153,994,514 probably null Het
Cpt1c A G 7: 44,959,501 *799R probably null Het
Csn2 A T 5: 87,694,559 M203K possibly damaging Het
Dclre1a C G 19: 56,538,369 A872P probably damaging Het
Dlg5 C A 14: 24,146,241 L1629F probably damaging Het
Dmxl1 A G 18: 49,878,925 D1383G probably damaging Het
Dnah6 A G 6: 73,144,941 V1381A probably damaging Het
Dnttip2 G T 3: 122,276,706 E523D probably benign Het
Dync2h1 A T 9: 7,114,883 V2425D probably damaging Het
Eif2a G A 3: 58,545,274 R199Q probably damaging Het
F10 T C 8: 13,039,564 F60L probably benign Het
Faf2 A G 13: 54,652,138 I253V probably benign Het
Fam71a A G 1: 191,163,061 S462P probably benign Het
Flt1 T A 5: 147,615,237 S715C probably damaging Het
Gm2056 A G 12: 88,027,307 S102G possibly damaging Het
Gm5150 G T 3: 15,990,896 T55K probably damaging Het
Gria1 T C 11: 57,185,933 F121L possibly damaging Het
Gucy2d A G 7: 98,454,064 Q505R probably benign Het
Gzma A T 13: 113,100,921 S11T probably benign Het
Hoxa6 G A 6: 52,208,555 Q24* probably null Het
Kcnj14 T A 7: 45,819,644 I146L possibly damaging Het
Kiss1r G A 10: 79,920,771 R149H probably damaging Het
Lama2 A G 10: 27,053,026 probably null Het
Lama5 C A 2: 180,179,493 R3092L probably damaging Het
Lca5l T A 16: 96,176,018 N196I probably damaging Het
Lig4 A G 8: 9,972,394 L462S probably damaging Het
Nbea A T 3: 56,004,868 V1166E probably benign Het
Nr2c1 T A 10: 94,181,603 F401Y probably benign Het
Olfr1335 T A 4: 118,808,998 R289* probably null Het
Olfr1431 A T 19: 12,209,922 M119L probably damaging Het
Olfr1507 A G 14: 52,490,373 I197T possibly damaging Het
Olfr299 A T 7: 86,465,617 M69L probably benign Het
Otop3 A C 11: 115,344,598 Y352S possibly damaging Het
Plekha6 T G 1: 133,272,637 L318R probably damaging Het
Pm20d1 G T 1: 131,816,087 V497F possibly damaging Het
Pnma2 G A 14: 66,917,123 R332H probably damaging Het
Ppip5k1 C A 2: 121,331,564 G1013C probably damaging Het
Prdm13 C G 4: 21,679,659 R277P unknown Het
Prdm2 A G 4: 143,132,104 S1539P possibly damaging Het
Ptger2 A G 14: 44,989,778 T272A probably damaging Het
Qser1 T C 2: 104,788,470 T576A probably benign Het
Rest GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC 5: 77,281,804 probably benign Het
Sacm1l G T 9: 123,568,956 V238L probably damaging Het
Sec16a C T 2: 26,423,633 G454D Het
Sil1 A G 18: 35,317,846 S259P possibly damaging Het
Sirpb1b A G 3: 15,574,904 L16P probably damaging Het
Slc22a20 A T 19: 5,982,851 V262D probably damaging Het
Slc4a9 G T 18: 36,533,623 R580L probably benign Het
Ssr3 A G 3: 65,383,100 V128A probably damaging Het
Stpg2 G T 3: 139,309,232 S386I possibly damaging Het
Taar8c C A 10: 24,101,602 C104F probably damaging Het
Tex2 T C 11: 106,567,269 E445G unknown Het
Tmem253 A C 14: 52,018,642 D126A probably benign Het
Tox4 A G 14: 52,285,790 Q69R possibly damaging Het
Tpi1 T A 6: 124,811,538 S254C probably benign Het
Trmt12 T G 15: 58,873,745 S331A probably benign Het
Ttn A G 2: 76,713,006 V33212A probably damaging Het
Tubb4a C T 17: 57,080,734 E431K unknown Het
Ugt1a10 A T 1: 88,055,787 E102D probably benign Het
Unc80 A T 1: 66,549,841 E1055V probably null Het
Vav1 C A 17: 57,311,895 S708R probably damaging Het
Vmn1r20 A G 6: 57,432,261 M191V probably damaging Het
Vmn1r37 A T 6: 66,732,070 T227S probably damaging Het
Vmn1r72 C A 7: 11,679,024 probably benign Het
Vps33b G A 7: 80,274,686 probably null Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Xirp1 G A 9: 120,018,236 T527M probably benign Het
Ylpm1 T A 12: 85,030,568 Y1356N probably damaging Het
Zfp980 A T 4: 145,701,454 Y251F possibly damaging Het
Zmym2 A T 14: 56,948,007 Y1032F probably damaging Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mean UTSW 10 41357563 missense possibly damaging 0.59
BB006:Ak9 UTSW 10 41383948 missense
BB016:Ak9 UTSW 10 41383948 missense
R0057:Ak9 UTSW 10 41392728 missense probably benign 0.04
R0605:Ak9 UTSW 10 41345139 missense probably damaging 1.00
R0658:Ak9 UTSW 10 41347222 missense probably damaging 0.98
R1696:Ak9 UTSW 10 41327589 missense possibly damaging 0.73
R1738:Ak9 UTSW 10 41335921 missense possibly damaging 0.86
R1815:Ak9 UTSW 10 41337576 missense probably damaging 1.00
R2900:Ak9 UTSW 10 41424755 missense unknown
R3123:Ak9 UTSW 10 41358580 missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41357512 missense probably damaging 0.96
R4092:Ak9 UTSW 10 41389144 missense probably benign 0.29
R4193:Ak9 UTSW 10 41335945 missense probably benign 0.14
R4598:Ak9 UTSW 10 41383911 missense probably damaging 1.00
R4621:Ak9 UTSW 10 41406891 missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41427238 missense unknown
R4707:Ak9 UTSW 10 41345460 missense probably benign 0.36
R4908:Ak9 UTSW 10 41420682 missense unknown
R4952:Ak9 UTSW 10 41420589 missense probably benign 0.07
R5162:Ak9 UTSW 10 41357657 missense probably damaging 1.00
R5446:Ak9 UTSW 10 41420509 missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41347169 missense probably damaging 1.00
R5517:Ak9 UTSW 10 41340891 missense probably benign 0.23
R5849:Ak9 UTSW 10 41348049 missense probably benign 0.31
R5858:Ak9 UTSW 10 41423027 missense unknown
R5920:Ak9 UTSW 10 41420676 missense probably benign 0.30
R5952:Ak9 UTSW 10 41357563 missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41358564 missense probably damaging 1.00
R6050:Ak9 UTSW 10 41389112 missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41382832 missense probably benign 0.01
R6190:Ak9 UTSW 10 41422407 missense unknown
R6190:Ak9 UTSW 10 41422408 missense unknown
R6197:Ak9 UTSW 10 41317830 missense probably damaging 0.98
R6220:Ak9 UTSW 10 41370099 missense unknown
R6250:Ak9 UTSW 10 41389034 missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41406841 missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41382829 missense probably damaging 0.99
R6812:Ak9 UTSW 10 41367167 missense unknown
R6847:Ak9 UTSW 10 41357801 splice site probably null
R7128:Ak9 UTSW 10 41424717 missense unknown
R7253:Ak9 UTSW 10 41432484 missense unknown
R7286:Ak9 UTSW 10 41407371 missense
R7401:Ak9 UTSW 10 41423004 missense unknown
R7478:Ak9 UTSW 10 41389091 missense
R7698:Ak9 UTSW 10 41348076 missense
R7758:Ak9 UTSW 10 41347132 missense
R7806:Ak9 UTSW 10 41433084 critical splice acceptor site probably null
R7894:Ak9 UTSW 10 41420539 missense unknown
R7929:Ak9 UTSW 10 41383948 missense
R7941:Ak9 UTSW 10 41409137 missense unknown
R8032:Ak9 UTSW 10 41424620 missense unknown
R8143:Ak9 UTSW 10 41337592 nonsense probably null
R8298:Ak9 UTSW 10 41389058 missense
R8301:Ak9 UTSW 10 41424716 missense
R8355:Ak9 UTSW 10 41399704 missense
R8703:Ak9 UTSW 10 41325124 missense
R8728:Ak9 UTSW 10 41406963 missense
R8757:Ak9 UTSW 10 41423040 missense unknown
R8798:Ak9 UTSW 10 41382851 missense
R8868:Ak9 UTSW 10 41317846 critical splice donor site probably null
R8868:Ak9 UTSW 10 41382873 nonsense probably null
R9088:Ak9 UTSW 10 41406874 missense
R9090:Ak9 UTSW 10 41424627 missense unknown
R9195:Ak9 UTSW 10 41407483 missense
R9271:Ak9 UTSW 10 41424627 missense unknown
R9297:Ak9 UTSW 10 41423085 missense unknown
R9302:Ak9 UTSW 10 41320490 missense
R9309:Ak9 UTSW 10 41316368 critical splice donor site probably null
R9318:Ak9 UTSW 10 41423085 missense unknown
R9393:Ak9 UTSW 10 41409072 missense unknown
R9541:Ak9 UTSW 10 41367177 missense
R9579:Ak9 UTSW 10 41337580 missense
R9618:Ak9 UTSW 10 41327631 missense
Z1176:Ak9 UTSW 10 41348251 missense
Z1176:Ak9 UTSW 10 41423023 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCATGGCTTACTAACCACC -3'
(R):5'- ATCTGAGGCCCAGGAACTAC -3'

Sequencing Primer
(F):5'- ATGGCTTACTAACCACCTGTCAG -3'
(R):5'- CTACATACACAACATTAGGCAGGAGG -3'
Posted On 2022-02-07