Incidental Mutation 'R0759:Nr0b2'
ID69999
Institutional Source Beutler Lab
Gene Symbol Nr0b2
Ensembl Gene ENSMUSG00000037583
Gene Namenuclear receptor subfamily 0, group B, member 2
SynonymsSHP-1, SHP, small heterodimer partner
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133553376-133556536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133553738 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 105 (Q105L)
Ref Sequence ENSEMBL: ENSMUSP00000039175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042706]
PDB Structure
Mouse SF-1 LBD [X-RAY DIFFRACTION]
Crystal Structure of SHP/EID1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000042706
AA Change: Q105L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039175
Gene: ENSMUSG00000037583
AA Change: Q105L

DomainStartEndE-ValueType
HOLI 60 231 1.08e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family of proteins. The encoded orphan receptor lacks a DNA binding domain but modulates gene expression by interacting with other hormone receptors to competitively inhibit binding of coactivators while also acting as a transcriptional corepressor. The encoded receptor may regulate bile acid synthesis and sexual maturation in males. Homozygous knockout mice exhibit accumulation of bile acids, reduced levels of low density lipoprotein cholesterol (LDL-C), and in male mice, earlier testicular maturation. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and exhibit no major defects in cholesterol metabolism under normal conditions. Under high cholesterol and cholic acid or iodine-deficient diets, mice exhibit decreased lipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Nr0b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Nr0b2 UTSW 4 133553738 missense probably damaging 1.00
R0310:Nr0b2 UTSW 4 133555992 splice site probably null
R0403:Nr0b2 UTSW 4 133553759 missense probably damaging 1.00
R0987:Nr0b2 UTSW 4 133556192 missense probably benign 0.00
R1005:Nr0b2 UTSW 4 133553474 missense probably benign 0.23
R4824:Nr0b2 UTSW 4 133556023 missense probably damaging 1.00
R5281:Nr0b2 UTSW 4 133556024 missense probably benign 0.01
R7942:Nr0b2 UTSW 4 133553536 missense probably benign
R8008:Nr0b2 UTSW 4 133556028 missense probably benign
R8263:Nr0b2 UTSW 4 133553930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTCGTCCGACTATTCTGTATG -3'
(R):5'- ACAATGGGTGTCAAGCCCCAAG -3'

Sequencing Primer
(F):5'- GTATGCACTTCTGAGCCCCAG -3'
(R):5'- CCAAGAAAGCACTTTCCTTGGATG -3'
Posted On2013-09-30