Incidental Mutation 'R0759:Tril'
ID70001
Institutional Source Beutler Lab
Gene Symbol Tril
Ensembl Gene ENSMUSG00000043496
Gene NameTLR4 interactor with leucine-rich repeats
Synonyms
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location53815468-53820830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53818027 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 737 (R737S)
Ref Sequence ENSEMBL: ENSMUSP00000116056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127748]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104970
Predicted Effect probably damaging
Transcript: ENSMUST00000127748
AA Change: R737S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116056
Gene: ENSMUSG00000043496
AA Change: R737S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 26 58 1.91e-1 SMART
LRR_TYP 82 105 3.49e-5 SMART
LRR_TYP 106 129 2.91e-2 SMART
LRR 130 153 9.96e-1 SMART
LRR 154 177 2.49e-1 SMART
LRR_TYP 178 201 1.67e-2 SMART
LRR 202 227 1.09e2 SMART
LRR_TYP 228 251 4.47e-3 SMART
LRR_TYP 252 275 1.84e-4 SMART
LRR 276 299 7.05e-1 SMART
LRR_TYP 300 323 1.3e-4 SMART
LRR 325 347 1.12e1 SMART
LRRCT 359 415 1.02e-2 SMART
low complexity region 448 465 N/A INTRINSIC
low complexity region 488 506 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
Blast:FN3 582 667 8e-34 BLAST
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
low complexity region 788 796 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204648
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TRIL is a component of the TLR4 (MIM 603030) complex and is induced in a number of cell types by lipopolysaccharide (LPS) (Carpenter et al., 2009 [PubMed 19710467]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Tril
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Tril APN 6 53819038 missense probably damaging 1.00
IGL03399:Tril APN 6 53820057 missense probably benign 0.01
R0036:Tril UTSW 6 53818633 missense probably benign
R0099:Tril UTSW 6 53818363 missense probably damaging 0.99
R0448:Tril UTSW 6 53817808 makesense probably null
R1296:Tril UTSW 6 53818027 missense probably damaging 0.98
R1472:Tril UTSW 6 53818027 missense probably damaging 0.98
R1888:Tril UTSW 6 53819592 missense probably damaging 1.00
R1888:Tril UTSW 6 53819592 missense probably damaging 1.00
R2108:Tril UTSW 6 53819083 missense probably damaging 1.00
R2290:Tril UTSW 6 53818027 missense probably damaging 0.98
R2291:Tril UTSW 6 53818027 missense probably damaging 0.98
R2367:Tril UTSW 6 53819166 missense probably damaging 1.00
R4021:Tril UTSW 6 53819019 missense probably damaging 1.00
R4753:Tril UTSW 6 53819713 missense probably damaging 1.00
R4755:Tril UTSW 6 53818464 missense probably damaging 0.99
R4981:Tril UTSW 6 53818920 missense probably benign 0.10
R5468:Tril UTSW 6 53819647 missense probably damaging 1.00
R5653:Tril UTSW 6 53817985 missense probably benign 0.32
R6434:Tril UTSW 6 53818508 missense probably damaging 1.00
R6724:Tril UTSW 6 53819574 missense possibly damaging 0.94
R7401:Tril UTSW 6 53818281 missense possibly damaging 0.54
R7582:Tril UTSW 6 53818936 missense probably benign
R8339:Tril UTSW 6 53817933 missense possibly damaging 0.84
Z1088:Tril UTSW 6 53818920 missense probably benign 0.45
Z1177:Tril UTSW 6 53819644 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGCATTGCCTAGTCAGCGAATC -3'
(R):5'- GTGTCTGACCCCTGTGACTTCAAC -3'

Sequencing Primer
(F):5'- TTGCAAGAGGTGATCCTCCC -3'
(R):5'- TCTGTGCAACCTGACAGTAG -3'
Posted On2013-09-30