Incidental Mutation 'R9259:Ppwd1'
ID 702125
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R9259 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 104205124-104228843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104223104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 130 (R130C)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
AlphaFold Q8CEC6
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: R130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: R130C

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,203,303 V1102A possibly damaging Het
Acot6 A G 12: 84,109,042 I255V possibly damaging Het
Adcy8 A T 15: 64,704,755 I986N probably damaging Het
Agr2 T A 12: 36,003,864 M164K probably damaging Het
Akap11 G A 14: 78,512,509 H813Y Het
Alas1 A T 9: 106,241,636 S195T probably benign Het
Aldoart1 T C 4: 72,852,443 T43A probably benign Het
Alms1 A G 6: 85,667,891 D2537G possibly damaging Het
Alpk3 A G 7: 81,093,554 T1040A probably damaging Het
Ankrd16 T C 2: 11,779,721 I120T probably damaging Het
Anks4b A G 7: 120,174,055 E46G probably benign Het
Ap3d1 A T 10: 80,723,827 V199E probably damaging Het
Atp1a3 A G 7: 24,997,531 S236P probably damaging Het
Atp5g2 T A 15: 102,663,126 N110I probably damaging Het
Cabin1 A G 10: 75,746,742 M280T probably benign Het
Cdc5l T C 17: 45,425,891 T134A possibly damaging Het
Clec4n C A 6: 123,235,465 P80Q probably damaging Het
Clip3 A G 7: 30,298,950 K274E probably benign Het
Cntrob A T 11: 69,320,839 D186E possibly damaging Het
Dcun1d3 A G 7: 119,857,829 V220A probably benign Het
Emsy A T 7: 98,593,550 N1127K probably benign Het
Entpd2 C T 2: 25,398,602 S206L probably damaging Het
Fam46c T C 3: 100,472,324 Y372C probably damaging Het
Fgd4 T C 16: 16,477,461 E218G probably damaging Het
Fkbp2 G T 19: 6,978,592 Q82K probably benign Het
Gpr161 T C 1: 165,310,456 Y204H probably damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gstt2 C T 10: 75,833,677 D59N possibly damaging Het
Havcr1 A T 11: 46,770,491 D206V probably damaging Het
Hoxb9 G A 11: 96,271,936 G132D probably damaging Het
Ifi44 C T 3: 151,749,238 V117M possibly damaging Het
Inhbe A G 10: 127,350,975 F112S probably damaging Het
Iqgap2 A T 13: 95,630,053 Y1481N probably damaging Het
Irak4 A T 15: 94,558,845 H303L probably damaging Het
Kdm5d A G Y: 942,640 E1435G possibly damaging Het
Kifc1 G T 17: 33,882,191 T599K possibly damaging Het
Klhl38 T C 15: 58,323,075 E86G probably benign Het
Mcub G C 3: 129,926,421 T141R probably benign Het
Moxd2 A T 6: 40,884,035 V274D probably damaging Het
Nol6 C T 4: 41,118,229 V803M possibly damaging Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pbld1 A G 10: 63,061,657 T46A possibly damaging Het
Peli3 T C 19: 4,934,458 D192G probably benign Het
Perm1 C T 4: 156,219,150 T717I probably benign Het
Pim1 G A 17: 29,491,207 A22T probably benign Het
Pkp2 C T 16: 16,225,850 P156L probably damaging Het
Prdm16 C A 4: 154,346,068 W321L possibly damaging Het
Ptprd T A 4: 76,071,963 D504V probably damaging Het
Pusl1 T C 4: 155,891,182 T65A probably damaging Het
Rtcb A G 10: 85,939,061 I490T probably damaging Het
Sec31b G T 19: 44,517,416 L967I probably damaging Het
Sec63 A C 10: 42,823,941 M666L probably benign Het
Sh3rf1 G C 8: 61,353,804 A379P probably benign Het
Slc7a12 T A 3: 14,481,316 L174I probably damaging Het
Sptbn4 C T 7: 27,367,699 S1935N possibly damaging Het
Susd6 A T 12: 80,851,256 Q55L probably benign Het
Tecpr2 A G 12: 110,931,433 E373G possibly damaging Het
Tm6sf2 A T 8: 70,077,935 I222L probably benign Het
Tsc22d1 T A 14: 76,417,044 V321E probably damaging Het
Tspoap1 A G 11: 87,779,524 N172S Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vcan G A 13: 89,690,870 S2185F probably damaging Het
Wapl G T 14: 34,741,095 V1131L probably benign Het
Zfp658 A G 7: 43,574,856 M852V probably benign Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104217206 missense probably damaging 1.00
R9354:Ppwd1 UTSW 13 104205572 missense probably benign 0.00
R9408:Ppwd1 UTSW 13 104209647 missense possibly damaging 0.74
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCTTTATCATCACCGACAGAG -3'
(R):5'- GCCTATTATTGAAGTAGCCAAATGC -3'

Sequencing Primer
(F):5'- TTTATCATCACCGACAGAGCAGAAC -3'
(R):5'- GCCAAATGCTGTCAGTCAATG -3'
Posted On 2022-03-25