Mutagenetix > Incidental Mutations

Incidental Mutation 'R2353:Ppwd1'

246269

Institutional Source

Beutler Lab

Gene Symbol

Ppwd1

Ensembl Gene

ENSMUSG00000021713

Gene Name

peptidylprolyl isomerase domain and WD repeat containing 1

Synonyms

4632422M10Rik, A330090G21Rik

MMRRC Submission

040335-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R2353 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104205124-104228843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104213582 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 432 (I432V)

Ref Sequence

ENSEMBL: ENSMUSP00000022226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022226]

Predicted Effect

probably benign
Transcript: ENSMUST00000022226
AA Change: I432V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: I432V

Domain	Start	End	E-Value	Type
WD40	80	117	2.96e-2	SMART
WD40	122	161	8.49e-3	SMART
Blast:WD40	164	207	9e-6	BLAST
WD40	211	251	2.76e0	SMART
WD40	269	308	1.4e-3	SMART
Blast:WD40	343	382	2e-6	BLAST
Blast:WD40	433	460	3e-7	BLAST
Pfam:Pro_isomerase	493	645	1.9e-52	PFAM

Meta Mutation Damage Score

0.0576

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,623,209	E345D	probably damaging	Het
Adam7	T	A	14: 68,505,088	Q692L	probably benign	Het
AF366264	T	A	8: 13,836,951	E380V	probably damaging	Het
Ankk1	A	C	9: 49,418,690	C322G	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Apeh	T	C	9: 108,086,292	D577G	possibly damaging	Het
Aspm	T	A	1: 139,477,697	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cd163	G	T	6: 124,319,156	E820*	probably null	Het
Cd38	T	A	5: 43,908,011		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,651,341	Q649H	probably benign	Het
Garnl3	T	A	2: 33,064,034	R86S	probably damaging	Het
Gbe1	A	G	16: 70,437,021		probably null	Het
Gm5117	A	G	8: 31,739,195		noncoding transcript	Het
Hip1	A	T	5: 135,412,712	V568E	probably damaging	Het
Hspa14	G	A	2: 3,511,176		probably null	Het
Lrrc4	A	G	6: 28,831,452	F55L	probably benign	Het
Med31	T	A	11: 72,214,140	N35I	probably damaging	Het
Msi1	C	A	5: 115,436,509		probably benign	Het
Olfr1270	A	T	2: 90,149,718	L96Q	probably damaging	Het
Olfr394	T	C	11: 73,887,834	I179M	probably benign	Het
Parl	T	C	16: 20,287,040	T211A	probably benign	Het
Scn10a	T	A	9: 119,638,687	I796F	probably damaging	Het
Sh3rf3	A	G	10: 59,007,073	D287G	probably damaging	Het
Sin3b	T	C	8: 72,724,152		probably null	Het
Ubr4	T	C	4: 139,433,673	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,000,136		probably null	Het
Zfp109	T	C	7: 24,229,381	D201G	probably benign	Het
Zfp407	A	G	18: 84,559,880	F1036S	probably damaging	Het
Znrf3	T	C	11: 5,281,170	E685G	probably damaging	Het

Other mutations in Ppwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ppwd1	APN	13	104217143	missense	probably damaging	1.00
IGL01582:Ppwd1	APN	13	104213704	missense	probably benign	0.01
IGL01697:Ppwd1	APN	13	104220464	missense	probably benign	0.01
IGL01771:Ppwd1	APN	13	104217116	missense	probably damaging	1.00
IGL02414:Ppwd1	APN	13	104223137	missense	probably benign
IGL02803:Ppwd1	APN	13	104213684	missense	probably benign	0.00
IGL02873:Ppwd1	APN	13	104209753	missense	probably damaging	1.00
F5770:Ppwd1	UTSW	13	104220237	missense	probably damaging	0.98
R0462:Ppwd1	UTSW	13	104222960	critical splice acceptor site	probably null
R1638:Ppwd1	UTSW	13	104220263	missense	probably damaging	1.00
R2211:Ppwd1	UTSW	13	104207142	missense	probably benign	0.26
R2226:Ppwd1	UTSW	13	104217245	missense	probably damaging	1.00
R2299:Ppwd1	UTSW	13	104220063	missense	probably benign
R2382:Ppwd1	UTSW	13	104207113	missense	probably damaging	1.00
R3123:Ppwd1	UTSW	13	104213690	missense	possibly damaging	0.90
R4521:Ppwd1	UTSW	13	104209659	missense	probably benign	0.16
R4972:Ppwd1	UTSW	13	104220108	missense	probably benign	0.00
R5125:Ppwd1	UTSW	13	104220435	missense	probably benign	0.14
R5178:Ppwd1	UTSW	13	104220435	missense	probably benign	0.14
R5468:Ppwd1	UTSW	13	104225444	missense	possibly damaging	0.52
R5638:Ppwd1	UTSW	13	104220398	missense	probably damaging	1.00
R6748:Ppwd1	UTSW	13	104208030	nonsense	probably null
R7095:Ppwd1	UTSW	13	104205626	missense	probably benign	0.21
R7201:Ppwd1	UTSW	13	104207172	missense	probably damaging	1.00
R7206:Ppwd1	UTSW	13	104213598	missense	probably damaging	0.99
R7664:Ppwd1	UTSW	13	104220290	missense	probably damaging	1.00
V7580:Ppwd1	UTSW	13	104220237	missense	probably damaging	0.98
V7581:Ppwd1	UTSW	13	104220237	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACAATATTAGTGCTGTAGGCTGG -3'
(R):5'- AGTTTGCCCTGTGGATCCTG -3'

Sequencing Primer
(F):5'- ATATTAGTGCTGTAGGCTGGTGTTTC -3'
(R):5'- CTGTGGATCCTGTCAAAAGCACTG -3'

Posted On

2014-10-30