Incidental Mutation 'R9418:Mta1'
ID 712187
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9418 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113098278-113137206 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 113131367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 415 (R415L)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
AlphaFold Q8K4B0
Predicted Effect
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: R415L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: R398L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: R398L

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: R415L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: R415L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: R398L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: R398L

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: R415L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: R415L

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A C 1: 93,159,988 L48V probably benign Het
4931440F15Rik C T 11: 29,824,632 C275Y probably damaging Het
A430033K04Rik G A 5: 138,647,055 G401R probably damaging Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Adgrf5 G A 17: 43,426,973 V233I probably benign Het
Ankrd34b A G 13: 92,438,724 K155E probably damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Ccdc141 A T 2: 77,041,422 H839Q probably benign Het
Ccdc18 T C 5: 108,155,803 L251P probably damaging Het
Ciita G T 16: 10,501,901 E63* probably null Het
Cmya5 T C 13: 93,089,701 T2960A probably benign Het
Cyp2b13 A T 7: 26,061,685 I56F probably benign Het
Dcaf4 A T 12: 83,539,832 Y422F probably benign Het
Dhrs7b A T 11: 60,855,768 I228F probably damaging Het
Drosha T C 15: 12,885,081 S853P probably benign Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Fap G A 2: 62,554,837 Q65* probably null Het
Fbxo47 T A 11: 97,856,241 N333I possibly damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gpr171 T C 3: 59,097,578 T259A possibly damaging Het
Hectd2 T A 19: 36,612,174 S595T probably benign Het
Hexa A G 9: 59,557,309 I161V probably benign Het
Hira A G 16: 18,951,275 T777A probably benign Het
Il2ra T C 2: 11,684,392 F244S possibly damaging Het
Kcne3 A G 7: 100,184,178 M1V probably null Het
Kcnj1 G A 9: 32,396,907 C209Y probably damaging Het
Kcnj2 A T 11: 111,072,531 I250F probably damaging Het
Krt26 C T 11: 99,337,915 probably benign Het
Leng9 T C 7: 4,148,355 T441A probably benign Het
Lingo2 T C 4: 35,709,035 H315R probably benign Het
Lrrc7 A T 3: 158,202,386 S266T possibly damaging Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mrc1 T C 2: 14,229,547 V12A probably benign Het
Mug2 T A 6: 122,040,741 V479E probably benign Het
Mylk3 C A 8: 85,364,815 M120I possibly damaging Het
Olfr1396 G T 11: 49,113,657 P23Q probably benign Het
Olfr157 C T 4: 43,835,879 V204M probably benign Het
Otog A T 7: 46,288,600 Q1911L probably benign Het
Pcdh20 C T 14: 88,468,019 C615Y probably benign Het
Pde1b A G 15: 103,525,037 H294R probably damaging Het
Phldb3 A T 7: 24,628,929 I633F probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pip5k1b A G 19: 24,350,217 V425A probably benign Het
Rab23 A T 1: 33,738,343 E179D probably benign Het
Slc12a6 C A 2: 112,344,210 L522I Het
Slc22a19 A T 19: 7,682,845 M400K possibly damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Spsb2 C A 6: 124,809,319 A5D probably damaging Het
Tgfb1 A G 7: 25,692,527 E169G probably damaging Het
Tm4sf5 T A 11: 70,510,308 C117S probably damaging Het
Tmcc3 T C 10: 94,579,225 L294P possibly damaging Het
Ubc T C 5: 125,387,402 Y287C probably damaging Het
Uroc1 G T 6: 90,336,898 V56F probably benign Het
Ush1c A T 7: 46,222,868 F237I probably damaging Het
Xxylt1 A T 16: 31,007,806 Y230* probably null Het
Zfp467 A T 6: 48,439,056 C221S probably damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 splice site probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
R7889:Mta1 UTSW 12 113131688 missense probably benign 0.02
R8136:Mta1 UTSW 12 113131678 missense probably damaging 1.00
R8176:Mta1 UTSW 12 113120836 missense probably benign 0.00
R8385:Mta1 UTSW 12 113131465 missense probably benign
R8398:Mta1 UTSW 12 113131622 missense possibly damaging 0.83
R9132:Mta1 UTSW 12 113136405 missense probably damaging 1.00
R9159:Mta1 UTSW 12 113136405 missense probably damaging 1.00
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ACCTGGAATGACTCACCATAGTGG -3'
(R):5'- TGTGACTGGAAGCCAAGGAC -3'

Sequencing Primer
(F):5'- TCACCATAGTGGGGCTGCAG -3'
(R):5'- AGGACCCGAGGCTGACATG -3'
Posted On 2022-05-16