Incidental Mutation 'R9439:Il20ra'
ID 713446
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 19743003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 66 (H66Q)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably benign
Transcript: ENSMUST00000020185
AA Change: H66Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: H66Q

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
AA Change: H66Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,287 E412D probably benign Het
Aak1 T A 6: 86,956,292 V415D probably damaging Het
Ache A C 5: 137,290,923 D297A probably damaging Het
Armc9 T C 1: 86,156,965 I4T possibly damaging Het
Atp8b2 T A 3: 89,944,185 Y925F Het
Avpr1b T C 1: 131,600,291 L184P probably damaging Het
Cabin1 G A 10: 75,745,235 P419L probably damaging Het
Ccdc88c T C 12: 100,918,338 S1578G probably benign Het
Ccnd2 A T 6: 127,150,654 C40* probably null Het
Col6a3 A T 1: 90,816,433 I471N probably damaging Het
Cp A G 3: 19,992,507 probably null Het
Cyfip2 C T 11: 46,200,841 R1084Q probably damaging Het
D11Wsu47e C T 11: 113,692,403 Q519* probably null Het
Diaph1 A G 18: 37,896,359 probably null Het
Dnah6 T C 6: 73,035,347 N3713S possibly damaging Het
Dot1l G T 10: 80,785,604 R633L possibly damaging Het
Ehmt1 A T 2: 24,825,018 M809K probably damaging Het
Fcgbp C A 7: 28,104,011 A1680E possibly damaging Het
Flt1 A G 5: 147,578,397 F1072L probably damaging Het
Gm19410 G T 8: 35,781,656 A549S probably damaging Het
Gnat1 A T 9: 107,676,312 I249N Het
Gp2 T C 7: 119,454,210 Y176C probably damaging Het
Gpc2 G T 5: 138,278,986 Q60K probably benign Het
Gpsm2 T A 3: 108,703,081 E21V probably damaging Het
Igkv4-80 T A 6: 69,016,809 M33L probably benign Het
Kap C T 6: 133,851,987 D61N probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mpp7 A T 18: 7,461,692 Y60* probably null Het
Neil1 T A 9: 57,143,814 R294* probably null Het
Nkx6-3 A G 8: 23,153,762 S60G probably benign Het
Noc2l T A 4: 156,241,673 S406T possibly damaging Het
Olfr113 A G 17: 37,574,934 I163T probably benign Het
Olfr279 T C 15: 98,498,366 V298A possibly damaging Het
Olfr325 T C 11: 58,581,278 C145R probably benign Het
Olfr510 T C 7: 108,667,419 M1T probably null Het
Olfr616 T G 7: 103,564,842 I146L probably benign Het
Olfr92 A G 17: 37,111,313 V223A probably damaging Het
Paqr4 A G 17: 23,739,965 F21L probably damaging Het
Pcdha9 A G 18: 36,998,474 T199A probably benign Het
Pcdhgb7 T C 18: 37,751,864 L29P probably benign Het
Pfkl G A 10: 77,995,338 A323V probably damaging Het
Pik3r4 C A 9: 105,650,842 P465T probably damaging Het
Pitpnm2 A G 5: 124,136,126 S307P probably damaging Het
Pitpnm2 A G 5: 124,140,596 Y191H probably damaging Het
Plod3 G A 5: 136,994,182 V613I probably benign Het
Prr23a2 C T 9: 98,856,868 T93I probably damaging Het
Ptk6 T A 2: 181,198,413 M267L possibly damaging Het
Rabl6 C T 2: 25,602,420 probably null Het
Ralgapa2 T C 2: 146,412,138 H787R probably benign Het
Rfx8 T G 1: 39,685,509 M231L probably benign Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Smpd4 A G 16: 17,641,587 I625V probably benign Het
Tcf7l1 A G 6: 72,788,757 S66P probably damaging Het
Tsc22d1 G A 14: 76,506,459 V1007M probably damaging Het
Tspoap1 C T 11: 87,774,709 R758C probably damaging Het
Vmn1r210 A C 13: 22,827,227 H296Q possibly damaging Het
Zfp532 G A 18: 65,685,643 V857I probably benign Het
Zfyve9 T C 4: 108,644,341 T593A probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGGGGCCATCTTTAGAGATC -3'
(R):5'- GAACGTTAACTGTTTCTGCCTC -3'

Sequencing Primer
(F):5'- CATCTTTAGAGATCAGCCAACTTAC -3'
(R):5'- GTTAACTGTTTCTGCCTCCACAAAAC -3'
Posted On 2022-05-16