Incidental Mutation 'R6755:Il20ra'
ID 531022
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6755 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19750794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 189 (Y189H)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably benign
Transcript: ENSMUST00000020185
AA Change: Y189H

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: Y189H

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,972 T364A probably benign Het
2210408I21Rik C T 13: 77,327,875 T1101M probably benign Het
4930433I11Rik T C 7: 40,994,310 S468P probably damaging Het
AA792892 A G 5: 94,381,409 T13A probably benign Het
Adam33 A G 2: 131,053,149 V637A probably damaging Het
Adcy5 G A 16: 35,303,634 V1228M possibly damaging Het
Ahi1 G T 10: 21,017,913 V848F probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
B4galt6 T C 18: 20,689,329 E264G probably benign Het
Bpifb4 A G 2: 153,957,738 T556A probably damaging Het
Bptf A T 11: 107,047,256 S64T probably benign Het
C3ar1 A G 6: 122,849,858 S467P probably benign Het
Cables1 G T 18: 11,939,825 S479I probably null Het
Cbl T C 9: 44,173,374 I155V probably damaging Het
Cdh16 T C 8: 104,619,248 D297G probably damaging Het
Cdk8 T A 5: 146,268,316 H102Q probably damaging Het
Cpn2 A T 16: 30,260,331 L184Q probably damaging Het
Ctso T A 3: 81,942,302 H109Q probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drc1 A G 5: 30,355,146 E299G probably damaging Het
Elp6 A G 9: 110,315,825 E150G possibly damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbn2 A G 18: 58,113,333 L499S possibly damaging Het
Fgf10 C A 13: 118,789,285 A200D probably damaging Het
Fhad1 T C 4: 141,964,604 E407G probably damaging Het
Hif1an T C 19: 44,568,452 V232A probably damaging Het
Ift172 T A 5: 31,260,998 K1214* probably null Het
Isg20l2 T A 3: 87,931,689 I69N probably benign Het
Kdelc1 C T 1: 44,110,734 probably null Het
Kif11 A G 19: 37,409,751 D675G probably benign Het
Klhdc7a T A 4: 139,966,475 D387V possibly damaging Het
Lrrc4 T C 6: 28,831,293 N108D probably damaging Het
Ltbp2 T A 12: 84,795,073 E944V probably damaging Het
Magi1 C T 6: 93,708,177 S740N probably damaging Het
Med26 A G 8: 72,495,833 I474T probably damaging Het
Mgst1 T A 6: 138,147,772 M68K probably damaging Het
Myh7 G A 14: 54,992,313 A91V possibly damaging Het
Nhlrc2 G A 19: 56,591,784 V450I probably benign Het
Nup160 T G 2: 90,700,456 F486C probably damaging Het
Obscn A T 11: 59,103,326 Y1602N probably damaging Het
Olfr629 T A 7: 103,740,500 T247S probably damaging Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otogl A T 10: 107,853,303 Y955* probably null Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pianp T C 6: 124,999,384 V52A probably benign Het
Plekhh2 T C 17: 84,591,585 Y997H probably damaging Het
Plekhm1 G T 11: 103,387,243 S342R possibly damaging Het
Ppp4r4 T A 12: 103,585,737 V81E probably damaging Het
Ptafr A G 4: 132,579,346 T16A probably benign Het
Ptpn23 A T 9: 110,389,787 L445Q probably damaging Het
Rasa1 A T 13: 85,226,598 F751L possibly damaging Het
Sap18 A C 14: 57,802,017 D153A probably damaging Het
Slc38a11 C T 2: 65,363,891 G10D probably benign Het
Snx32 T C 19: 5,510,344 N10D probably benign Het
Sox6 T C 7: 115,662,442 T180A probably damaging Het
Srrt T C 5: 137,302,930 K78R probably damaging Het
Syce3 T C 15: 89,397,364 D24G probably damaging Het
Taok3 T A 5: 117,206,667 I153N probably damaging Het
Tesk1 A G 4: 43,445,991 Q308R probably benign Het
Tm7sf3 A T 6: 146,609,973 probably null Het
Tmbim6 T C 15: 99,402,153 V50A probably benign Het
Tmem107 T C 11: 69,071,011 V22A probably damaging Het
Ttc12 T C 9: 49,453,346 I377V probably benign Het
Ufl1 T A 4: 25,262,316 N310I probably damaging Het
Ush2a C A 1: 188,443,219 N1171K possibly damaging Het
Utrn A T 10: 12,699,087 V1032E probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6543:Il20ra UTSW 10 19749323 missense probably damaging 1.00
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATAGCTTTACCTCAGGGGAG -3'
(R):5'- ACAGAGTGCTTGCCTTGTATCTTG -3'

Sequencing Primer
(F):5'- TCACACCTAAAGATGTTTATACCCTC -3'
(R):5'- GCCTTGTATCTTGTGTGATATCTC -3'
Posted On 2018-08-01