Incidental Mutation 'R9568:Ptgs2'

• ID: 721732
• Institutional Source: Beutler Lab
• Gene Symbol: Ptgs2
• Ensembl Gene: ENSMUSG00000032487
• Gene Name: prostaglandin-endoperoxide synthase 2
• Synonyms: prostaglandin G/H synthase, Pghs2, PGHS-2, cyclooxygenase-2, cyclooxygenase 2, COX2, Cox-2, Tis10, PHS-2
• Essential gene?: Probably essential (E-score: 0.786)
• Stock #: R9568 (G1)
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 1
• Chromosomal Location: 149975851-149983978 bp(+) (GRCm39)
• Type of Mutation: critical splice donor site (1 bp from exon)
• DNA Base Change (assembly): G to T at 149976842 bp (GRCm39)
• Zygosity: Heterozygous
• Ref Sequence: ENSEMBL: ENSMUSP00000035065
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
• AlphaFold: Q05769
• PDB Structure: CRYSTAL STRUCTURE OF ARACHIDONIC ACID BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION] ; CYCLOOXYGENASE-2 (PROSTAGLANDIN SYNTHASE-2) COMPLEXED WITH A SELECTIVE INHIBITOR, SC-558 [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF A MIXTURE OF ARACHIDONIC ACID AND PROSTAGLANDIN BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2: PROSTAGLANDIN STRUCTURE [X-RAY DIFFRACTION] ; CRYSTAL STRUCTURE OF DICLOFENAC BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION] ; X-ray crystal structure of arachidonic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION] ; X-ray crystal structure of eicosapentaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION] ; X-ray crystal structure of docosahexaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION] ; X-ray crystal structure of arachidonic acid bound in the cyclooxygenase channel of L531F murine COX-2 [X-RAY DIFFRACTION] ; Structure of compound 5c-S bound at the active site of COX-2 [X-RAY DIFFRACTION] ; Structure of celecoxib bound at the COX-2 active site [X-RAY DIFFRACTION] ; >> 23 additional structures at PDB <<
• Predicted Effect: probably null; Transcript: ENSMUST00000035065
• SMART Domains: Protein: ENSMUSP00000035065; Gene: ENSMUSG00000032487

Domain	Start	End	E-Value	Type
EGF	20	55	2.64e1	SMART
low complexity region	182	198	N/A	INTRINSIC
Pfam:An_peroxidase	206	562	7.3e-48	PFAM

• Predicted Effect: probably benign; Transcript: ENSMUST00000190784
• SMART Domains: Protein: ENSMUSP00000139904; Gene: ENSMUSG00000032487

Domain	Start	End	E-Value	Type
Blast:EGF	1	23	2e-9	BLAST
SCOP:d1eqga2	1	26	5e-8	SMART
PDB:1CVU|B	1	62	1e-38	PDB
SCOP:d1cvua1	27	62	1e-20	SMART

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
• MGI Phenotype: FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015] ; PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
• Posted On: 2022-08-09

Predicted Primers

PCR Primer
(F):5'- CATTGTAAAGTTGACCCATAGTGACAG -3'
(R):5'- GGTCAGGATGTAGTGCACTG -3'

Sequencing Primer
(F):5'- TGACCCATAGTGACAGAATTAAATCC -3'
(R):5'- CAGGATGTAGTGCACTGTGTTTG -3'