Incidental Mutation 'R9585:Pth1r'
ID 722754
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH/PTHrP receptor, PTH-related peptide receptor, PTH1R, PPR, Pthr1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110551153-110576213 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110573847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 3 (R3S)
Ref Sequence ENSEMBL: ENSMUSP00000142672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862] [ENSMUST00000200011]
AlphaFold P41593
Predicted Effect probably benign
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
AA Change: R3S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492
AA Change: R3S

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200011
SMART Domains Protein: ENSMUSP00000142530
Gene: ENSMUSG00000059741

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:EF-hand_6 62 93 4.7e-3 PFAM
internal_repeat_1 140 182 5.24e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T A 3: 124,199,993 (GRCm39) D533V possibly damaging Het
4933411K16Rik A G 19: 42,041,352 (GRCm39) E161G probably benign Het
Abca12 A G 1: 71,342,745 (GRCm39) S912P probably damaging Het
Abca3 G A 17: 24,619,486 (GRCm39) M1196I probably benign Het
Adprs A T 4: 126,211,786 (GRCm39) D175E probably benign Het
Asrgl1 A G 19: 9,090,398 (GRCm39) L316P probably benign Het
Avl9 T A 6: 56,734,299 (GRCm39) M626K probably damaging Het
Birc6 A G 17: 74,916,265 (GRCm39) N1727S probably damaging Het
Casp14 G A 10: 78,549,194 (GRCm39) R251W probably damaging Het
Cfap69 A G 5: 5,631,269 (GRCm39) I919T possibly damaging Het
Cibar2 T C 8: 120,901,450 (GRCm39) E85G probably null Het
Cps1 T A 1: 67,195,341 (GRCm39) M254K probably damaging Het
Ctc1 A G 11: 68,925,490 (GRCm39) E1009G probably damaging Het
Ddx25 A T 9: 35,455,009 (GRCm39) Y426* probably null Het
Dok3 A G 13: 55,672,057 (GRCm39) F207S probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Fcrla A T 1: 170,749,868 (GRCm39) M1K probably null Het
Heatr4 A T 12: 84,014,472 (GRCm39) S588R probably damaging Het
Iglv3 A G 16: 19,059,960 (GRCm39) *123Q probably null Het
Igsf9b T C 9: 27,233,532 (GRCm39) I344T probably damaging Het
Il18 T C 9: 50,490,661 (GRCm39) S99P probably damaging Het
Krt36 G A 11: 99,994,892 (GRCm39) L227F probably damaging Het
Lrriq1 A G 10: 103,051,250 (GRCm39) S501P probably benign Het
Lvrn T C 18: 47,011,411 (GRCm39) probably null Het
Myo18a T A 11: 77,709,495 (GRCm39) M535K probably benign Het
Myocd T A 11: 65,095,192 (GRCm39) S158C probably damaging Het
Naip6 A T 13: 100,436,577 (GRCm39) C649S probably damaging Het
Oasl2 T C 5: 115,035,901 (GRCm39) V59A probably damaging Het
Obscn C A 11: 58,965,831 (GRCm39) V2942F probably benign Het
Or10a49 T A 7: 108,467,552 (GRCm39) T270S probably benign Het
Or5l14 T A 2: 87,792,919 (GRCm39) T106S probably benign Het
Osbpl6 A G 2: 76,354,438 (GRCm39) T18A probably benign Het
Pcf11 A T 7: 92,311,006 (GRCm39) D327E probably benign Het
Per3 G T 4: 151,097,138 (GRCm39) Q796K probably benign Het
Pex5l T C 3: 33,060,091 (GRCm39) T227A probably benign Het
Phf11b G T 14: 59,568,704 (GRCm39) P70T probably benign Het
Pkd1l1 T G 11: 8,804,390 (GRCm39) I2184L Het
Polr3a A T 14: 24,502,289 (GRCm39) M1288K probably damaging Het
Ptprk C A 10: 28,369,147 (GRCm39) Y706* probably null Het
Rmi2 C T 16: 10,703,983 (GRCm39) T108I probably benign Het
Rrbp1 T C 2: 143,799,479 (GRCm39) N1076S probably benign Het
Setd3 A C 12: 108,074,814 (GRCm39) probably null Het
Slc4a1 A G 11: 102,247,915 (GRCm39) Y360H probably benign Het
Sox21 A G 14: 118,472,993 (GRCm39) S19P possibly damaging Het
Speer4a2 T C 5: 26,291,542 (GRCm39) H88R possibly damaging Het
Stx18 T A 5: 38,249,916 (GRCm39) N76K possibly damaging Het
Sv2c T C 13: 96,122,466 (GRCm39) T437A probably benign Het
Trrap G A 5: 144,777,330 (GRCm39) V3043M probably damaging Het
Vps50 T A 6: 3,600,348 (GRCm39) S936T probably benign Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110,556,198 (GRCm39) missense probably damaging 0.99
IGL01682:Pth1r APN 9 110,552,774 (GRCm39) splice site probably null
IGL02004:Pth1r APN 9 110,571,376 (GRCm39) intron probably benign
IGL02169:Pth1r APN 9 110,553,503 (GRCm39) missense probably damaging 1.00
IGL02548:Pth1r APN 9 110,556,748 (GRCm39) missense probably damaging 1.00
IGL03201:Pth1r APN 9 110,551,648 (GRCm39) missense probably damaging 1.00
R0070:Pth1r UTSW 9 110,556,618 (GRCm39) splice site probably null
R0881:Pth1r UTSW 9 110,560,641 (GRCm39) missense probably damaging 1.00
R1022:Pth1r UTSW 9 110,571,295 (GRCm39) missense probably damaging 0.96
R1022:Pth1r UTSW 9 110,558,689 (GRCm39) missense probably benign 0.01
R1024:Pth1r UTSW 9 110,571,295 (GRCm39) missense probably damaging 0.96
R1024:Pth1r UTSW 9 110,558,689 (GRCm39) missense probably benign 0.01
R2071:Pth1r UTSW 9 110,556,081 (GRCm39) missense probably benign 0.34
R2197:Pth1r UTSW 9 110,556,058 (GRCm39) unclassified probably benign
R2206:Pth1r UTSW 9 110,552,655 (GRCm39) missense probably damaging 1.00
R4184:Pth1r UTSW 9 110,571,300 (GRCm39) start codon destroyed probably null
R4590:Pth1r UTSW 9 110,551,339 (GRCm39) missense probably benign 0.04
R4638:Pth1r UTSW 9 110,556,141 (GRCm39) missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110,560,692 (GRCm39) missense probably damaging 1.00
R5457:Pth1r UTSW 9 110,555,522 (GRCm39) missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110,551,384 (GRCm39) missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110,556,319 (GRCm39) splice site probably null
R6683:Pth1r UTSW 9 110,556,319 (GRCm39) splice site probably null
R6914:Pth1r UTSW 9 110,557,084 (GRCm39) splice site probably null
R6942:Pth1r UTSW 9 110,557,084 (GRCm39) splice site probably null
R7164:Pth1r UTSW 9 110,552,815 (GRCm39) missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110,551,461 (GRCm39) missense probably benign
R7883:Pth1r UTSW 9 110,560,626 (GRCm39) missense probably benign 0.02
R8966:Pth1r UTSW 9 110,554,229 (GRCm39) missense possibly damaging 0.79
R9168:Pth1r UTSW 9 110,556,204 (GRCm39) missense probably benign 0.31
R9773:Pth1r UTSW 9 110,556,233 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGACACCAGAGTTCTAGACTTTG -3'
(R):5'- TCAGGACCCATTGTCACTGAG -3'

Sequencing Primer
(F):5'- AGAGTTCTAGACTTTGGACTTCC -3'
(R):5'- ACCCATTGTCACTGAGGTGTG -3'
Posted On 2022-08-09