Incidental Mutation 'R9635:Dnmbp'
ID 725779
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43867535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 261 (A261S)
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026209
AA Change: A1018S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: A1018S

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212032
AA Change: A1014S

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212048
AA Change: A702S

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212396
AA Change: A1018S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212592
AA Change: A261S

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A T 5: 4,050,545 T2736S probably benign Het
AW209491 T C 13: 14,637,372 V270A probably benign Het
Best3 A T 10: 117,002,545 K169N probably damaging Het
Cabyr A G 18: 12,750,759 K101R probably damaging Het
Chd5 A T 4: 152,376,622 D1223V possibly damaging Het
Commd2 T C 3: 57,651,643 D4G probably benign Het
Cyp3a41a A T 5: 145,715,510 F60I possibly damaging Het
D6Ertd527e G C 6: 87,111,857 S334T unknown Het
Fcgbp A C 7: 28,101,407 T1293P probably benign Het
Gal3st2b A C 1: 93,941,055 N336T probably benign Het
Gm10309 T C 17: 86,499,066 T7A unknown Het
Gm10322 A T 10: 59,616,109 H16L possibly damaging Het
Gm11273 T C 13: 21,501,124 T99A probably benign Het
Gm4788 C T 1: 139,774,026 V117I probably damaging Het
Gpr17 A G 18: 31,947,146 L288P probably damaging Het
Ighe T C 12: 113,272,279 I142M Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Lrrk2 T A 15: 91,812,324 D2438E probably benign Het
Map3k20 G A 2: 72,402,059 S353N possibly damaging Het
Moxd2 T A 6: 40,886,066 D102V possibly damaging Het
Obscn T C 11: 59,081,860 E2120G possibly damaging Het
Olfr1291-ps1 T A 2: 111,499,922 C223* probably null Het
Olfr507 A G 7: 108,622,447 I212V probably benign Het
Olfr787 T C 10: 129,463,594 V306A probably benign Het
Pcdhb5 A T 18: 37,321,457 T297S probably benign Het
Pdcd2l A C 7: 34,192,931 L171R possibly damaging Het
Ppp4r3b T C 11: 29,188,113 S154P probably benign Het
Prc1 T G 7: 80,312,299 M515R probably benign Het
Rbm34 A G 8: 126,970,122 S77P probably damaging Het
Samsn1 T G 16: 75,876,569 T140P probably damaging Het
Slc34a1 G A 13: 55,409,127 V379M probably damaging Het
Stab2 T A 10: 86,850,787 R2298* probably null Het
Trim10 G A 17: 36,876,998 V369M probably damaging Het
Trpv6 T C 6: 41,622,967 N585S possibly damaging Het
Ttn C T 2: 76,756,273 D21765N possibly damaging Het
Ubxn6 A G 17: 56,069,189 L349P probably damaging Het
Vdac3 A T 8: 22,587,559 S37R probably damaging Het
Vmn1r124 G A 7: 21,259,795 L275F probably benign Het
Wdr17 A T 8: 54,648,340 I964N probably damaging Het
Zdhhc22 A G 12: 86,983,622 F184S possibly damaging Het
Zfp512 A G 5: 31,466,325 H124R probably benign Het
Zswim4 T C 8: 84,212,725 T843A probably damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTGCAGATTATACGCAGCTTGG -3'
(R):5'- TGGTTCCGATTTAGAGAAGCC -3'

Sequencing Primer
(F):5'- TTGGTAGCTGCAGGGCC -3'
(R):5'- ATTTAGAGAAGCCTCGCGTC -3'
Posted On 2022-09-12