Incidental Mutation 'R0965:Slc7a5'
ID81612
Institutional Source Beutler Lab
Gene Symbol Slc7a5
Ensembl Gene ENSMUSG00000040010
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 5
SynonymsTA1, D0H16S474E, LAT1
MMRRC Submission 039094-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0965 (G1)
Quality Score175
Status Not validated
Chromosome8
Chromosomal Location121881150-121907694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121907101 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 169 (E169G)
Ref Sequence ENSEMBL: ENSMUSP00000041557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045557] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000045557
AA Change: E169G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041557
Gene: ENSMUSG00000040010
AA Change: E169G

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:AA_permease_2 51 481 4.2e-65 PFAM
Pfam:AA_permease 56 489 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181944
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG 4: 129,992,416 probably benign Het
Amacr C T 15: 10,984,805 R170C probably damaging Het
Bcl2 A T 1: 106,712,291 L197Q probably benign Het
Brd1 G A 15: 88,717,028 R468W probably damaging Het
Esco1 A G 18: 10,567,570 F821L probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gzma G A 13: 113,098,334 P38L probably damaging Het
Mcc A G 18: 44,724,526 L174P probably benign Het
Med19 A G 2: 84,678,449 E2G probably damaging Het
Muc5b C T 7: 141,863,802 T3495I possibly damaging Het
Nfatc4 T C 14: 55,826,586 S107P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1015 A G 2: 85,786,299 S263G probably damaging Het
Phf11c T A 14: 59,381,482 I285F probably damaging Het
Prkdc T C 16: 15,829,716 V3668A probably benign Het
Rbm20 T C 19: 53,859,401 F1126S probably damaging Het
Slco1b2 C A 6: 141,685,596 T652K probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tmem119 A C 5: 113,795,419 V107G probably damaging Het
Ttn C A 2: 76,799,571 G14205V probably damaging Het
Zc3h11a T C 1: 133,645,803 N33S possibly damaging Het
Other mutations in Slc7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02192:Slc7a5 APN 8 121886390 intron probably benign
R0364:Slc7a5 UTSW 8 121885015 missense probably benign
R0580:Slc7a5 UTSW 8 121885116 missense probably benign 0.21
R1274:Slc7a5 UTSW 8 121883714 missense probably benign 0.44
R2135:Slc7a5 UTSW 8 121883705 missense probably null 0.96
R4163:Slc7a5 UTSW 8 121888400 missense probably benign 0.00
R4506:Slc7a5 UTSW 8 121887495 critical splice donor site probably null
R4910:Slc7a5 UTSW 8 121885122 missense probably damaging 0.96
R5243:Slc7a5 UTSW 8 121896535 missense probably damaging 1.00
R5449:Slc7a5 UTSW 8 121886348 missense probably damaging 1.00
R5719:Slc7a5 UTSW 8 121883642 missense probably benign 0.00
R5744:Slc7a5 UTSW 8 121888382 missense probably benign 0.00
R7473:Slc7a5 UTSW 8 121888423 missense probably benign
R7499:Slc7a5 UTSW 8 121883722 missense probably damaging 1.00
R7663:Slc7a5 UTSW 8 121887535 nonsense probably null
R7680:Slc7a5 UTSW 8 121907267 missense probably damaging 1.00
R7682:Slc7a5 UTSW 8 121907140 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTGCCGAGATGGTTCAGGGATG -3'
(R):5'- GCGCAATATCACGCTGCTCAAC -3'

Sequencing Primer
(F):5'- TGGTTCAGGGATGGACAGATG -3'
(R):5'- ATCATCGTGGGCACCATC -3'
Posted On2013-11-08