Incidental Mutation 'R0946:Pign'
ID82084
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R0946 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105591697 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 500 (M500K)
Ref Sequence ENSEMBL: ENSMUSP00000140020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect probably benign
Transcript: ENSMUST00000070699
AA Change: M500K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: M500K

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186485
AA Change: M500K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: M500K

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187537
AA Change: M500K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: M500K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190811
AA Change: M500K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: M500K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Ercc6 A T 14: 32,552,621 M574L probably benign Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
R7361:Pign UTSW 1 105585053 missense probably benign 0.01
R7582:Pign UTSW 1 105649367 missense probably benign 0.00
R7622:Pign UTSW 1 105648117 missense possibly damaging 0.65
R7742:Pign UTSW 1 105552397 missense probably benign
R7892:Pign UTSW 1 105657676 missense probably benign 0.01
R8273:Pign UTSW 1 105589078 missense probably benign 0.00
R8352:Pign UTSW 1 105648192 missense probably benign 0.35
R8452:Pign UTSW 1 105648192 missense probably benign 0.35
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Z1177:Pign UTSW 1 105657820 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- AGAAACAAACCAGGTCACTGTTTCCTC -3'
(R):5'- GAGCGTTGAATAGGCAGAAACTTTTCC -3'

Sequencing Primer
(F):5'- CAGGTCACTGTTTCCTCAAAGAAG -3'
(R):5'- gcccttgtgagctagacc -3'
Posted On2013-11-08