Incidental Mutation 'R0946:Ercc6'
ID82124
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 039085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R0946 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32552621 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 574 (M574L)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably benign
Transcript: ENSMUST00000066807
AA Change: M574L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: M574L

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228035
Predicted Effect unknown
Transcript: ENSMUST00000228549
AA Change: M16L
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,165,696 N122K possibly damaging Het
9230112D13Rik A G 14: 34,512,142 M64T unknown Het
Adamts15 C T 9: 30,902,197 G891R probably damaging Het
Adck5 G A 15: 76,593,286 V107I possibly damaging Het
Aoc3 G A 11: 101,332,305 V456M possibly damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Camsap3 A G 8: 3,604,442 H693R probably benign Het
Ccdc88a A G 11: 29,456,509 T414A probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Coasy G T 11: 101,085,870 V489F probably damaging Het
Esrrb T C 12: 86,505,824 L180P probably damaging Het
Fam83b A T 9: 76,491,397 V808D probably damaging Het
Fat3 C T 9: 15,997,804 V2301I possibly damaging Het
Gm813 C A 16: 58,614,712 R83S probably damaging Het
Gm9573 A C 17: 35,618,213 S1581A probably benign Het
Hyal4 T A 6: 24,755,913 Y43* probably null Het
Hydin C A 8: 110,531,053 L2372M probably benign Het
Lrrc4c T C 2: 97,629,464 V145A probably benign Het
Myh4 A G 11: 67,251,751 I913V possibly damaging Het
Nat10 C T 2: 103,731,374 G654D probably damaging Het
Nbn A T 4: 15,970,719 probably null Het
Oas3 T C 5: 120,769,063 Y503C unknown Het
Olfr740 C A 14: 50,453,673 T207K probably benign Het
Pappa G T 4: 65,314,792 probably null Het
Pfas A G 11: 68,993,295 probably null Het
Pfas G T 11: 68,990,747 probably null Het
Pign A T 1: 105,591,697 M500K probably benign Het
Pkhd1 T C 1: 20,199,381 K3313R probably benign Het
Ptk2b A G 14: 66,158,598 V807A probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Rfpl4b A T 10: 38,820,837 I256N probably benign Het
Skap1 C G 11: 96,541,469 S88* probably null Het
Slc4a2 T C 5: 24,435,886 S742P probably damaging Het
Supv3l1 T C 10: 62,429,820 D647G probably damaging Het
Tmem184c A C 8: 77,604,757 V121G probably damaging Het
Tonsl T C 15: 76,623,221 I118V probably benign Het
Top1 T A 2: 160,712,668 Y446* probably null Het
Trim37 A G 11: 87,146,955 R172G probably damaging Het
Vgll4 C A 6: 114,890,807 probably null Het
Vgll4 T A 6: 114,890,808 probably null Het
Vmn1r5 T G 6: 56,986,165 I275S possibly damaging Het
Vwde A T 6: 13,187,875 H584Q probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp282 T A 6: 47,880,009 W59R probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zswim2 T A 2: 83,923,759 T186S probably benign Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
R7802:Ercc6 UTSW 14 32517303 missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32562569 missense probably damaging 0.99
R8181:Ercc6 UTSW 14 32557948 missense probably damaging 1.00
R8320:Ercc6 UTSW 14 32521015 missense probably benign 0.01
R8388:Ercc6 UTSW 14 32570340 utr 3 prime probably benign
Z1176:Ercc6 UTSW 14 32526487 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGTTGGGTTCATACAGATTTTCCCCAC -3'
(R):5'- TTGTGATCCCATGCATACGGTCGG -3'

Sequencing Primer
(F):5'- CATACAGATTTTCCCCACTATAGC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-11-08